Anti-Cancer Effects and Tumor Marker Role of Glutathione S-Transferase Mu 5 in Human Bladder Cancer

The GSTM5 mRNA expression data of patients with bladder cancer were extracted from the publicly available Oncomine database. After data-mining for GSTM5 and bladder cancer in cancer vs. normal differential analysis (p < 0.001, fold change >1.5, gene rank the top 10%), three mRNA databases exhibited differential expression (Sanchez-Carbayo bladder 2, Lee bladder and Dyrskjot bladder 3). In these three databases, GSTM5 mRNA was downregulated in superficial and infiltrating bladder tumor tissues compared with normal tissues (Figure 1), suggesting that GSTM5 may play a tumor suppressor role in human bladder cancer.

In our previous study [24], GSTM5 mRNA expression was enhanced in 5637 bladder cancer cells following treatment with 10 µM 5-aza-dC; the DNA CpG methylation level of the GSTM5 promoter was also decreased from 84.6 to 61.5%. In the present study, 5-aza-dC administration also increased GSTM5 mRNA (Figure 2A) and protein (Figure 2B) expression in 5637 cells and to a greater degree in RT4 cells (Figure 2A,B).

In view of the inhibited gene activation and expression of GSTM5 caused by DNA CpG methylation, the DNA methylation level of GSTM5 was analyzed using tumors from patients with bladder cancer and urine pellets from healthy individuals with no previous history of bladder cancer. The characteristics of the study population are listed in Table 1. Though the mean age was different between patients and healthy subjects (Table 1), the correlation between age and GSTM5 DNA methylation level in the 100 volunteers was not statistically significant (Figure 2C). Though the sex distribution was also different between patients and healthy subjects, the GSTM5 DNA methylation level was no difference between male and female subjects (p = 0.7) (Table 2). When comparing 50 patients with 50 healthy subjects, GSTM5 DNA methylation level was significantly higher in bladder cancer tissues than in healthy urine pellets (Figure 2D). After the DNA methylation levels were classified into three levels, including low (<30%), medium (≥30% and <75%) and high (≥75%), the difference between healthy subjects and patients with bladder cancer also reached significance (p = 0.003) (Table 3). Differences between GSTM5 DNA methylation levels at various cancer stages were also analyzed, and the results also indicated a significant difference (Table 4). These findings suggest that hypermethylation of the GSTM5 gene represents an essential biomarker of bladder cancer, which results in the lower mRNA expression levels observed in Figure 1. Analysis of publicly available clinical survival data associated with GSTM5 expression (Kaplan–Meier Plotter, https://kmplot.com/analysis/↗, accessed on 20 November 2020) is displayed in Figure 2E,F. These data indicate that high GSTM5 expression may increase the probability of relapse-free survival in patients with bladder cancer (Figure 2F).

In addition, the GSTM1-null ratio was also analyzed in the 100 study volunteers by using the multiplex PCR method according to our previous study [24]. However, no significant differences were observed between normal subjects (62%) and those with bladder cancer (64%).

In addition to GSTM5 and GSTM1, there are another 3 members in the GSTM family, including GSTM2-4. GSTM1~5 share 66 to 88% amino acid sequence similarity. GSTM2 is known to play a tumor suppressor role [21], and functional characteristics that may also be shared GSTM5 (Figure 1); therefore, the effects of GSTM1-5 on cell viability were compared by overexpressing these proteins in 5637 cells. GSTM1-5 were transiently overexpressed in 5637 cells and detected by anti-DDK flag (Figure 3A) or anti-GSTM1-5-specific antibodies (Figure 3B). The molecular weight of the overexpressed GSTMs was about 28–29 kDa, which is slightly greater than that of endogenous GSTMs (about 26 kDa). As shown in Figure 3A, the cell viability was significantly decreased in GSTM2, GSTM3 and GSTM5-overexpressed cells. Figure 3B indicates that anti-GSTM2 and -GSTM3 antibodies have a higher specificity than those against GSTM1, GSTM4 and GSTM5. Due to the nonspecific activity of the anti-GSTM5 antibody from GeneTex, another antibody from Abnova was used to generate the data presented in Figure 2B and Figure 4A. As the primary function of GSTs is to catalyze the conjugation of GSH to a wide variety of electrophilic substrates, the enzyme activity was also compared in 5637 cells overexpressing GSTM1-5, using CDNB as a substrate. The results suggested that GSTM1 possessed the greatest enzymatic activity (Figure 3C). Considering the differences in substrate binding affinity between GSTM1-5, the findings may not represent the real enzymatic activity of all cells overexpressing GSTMs; therefore, the cellular GSH level was also selected to assess the enzyme activity because the glutathione transferase consumes GSH as a result of this enzyme reaction. Figure 3D indicates that cellular GSH levels were decreased in cells overexpressing GSTM2 and GSTM5 but increased in GSTM3-overexpressed cells. Among them, GSTM5 overexpression depleted GSH levels to the greatest degree. The phenomenon of GSTM5 overexpression-reduced GSH cellular level was confirmed in two additional bladder cancer cell lines, RT4 and BFTC 905 (Figure 3E).

The conjugation of GSH with various electrophilic compounds is supposed to decrease the cellular damage caused by the reactive compounds. However, the process also depletes cellular GSH, which is integral to other protective mechanisms in addition to glutathione transferase, including the glutathione peroxidase pathway. Since GSTM5 decreased GSH levels to a greater degree than the other GSTMs (Figure 3D), the potential effect of this GSTM5-induced GSH reduction in cellular activity was investigated. After stable overexpression, the protein levels of GSTM5 were significantly increased in 5637 cells (5637ovGSTM5) (Figure 4A). The cellular GSH concentration was also decreased in 5637ovGSTM5 cells compared with those transfected with the vector control (5637VC) (Figure 4B).

The cell viability was significantly decreased after transient GSTM5 expression (Figure 3A). In the stable cell lines, the effects of GSTM5 on the proliferative rate and colony formation ability were analyzed. The results indicated that the cell proliferation and the number of colonies in soft agarose were decreased by GSTM5 overexpression (Figure 4C,D). Moreover, the migration activity of 5637ovGSTM5 cells was significantly lower than that of 5637VC cells by Transwell assay (Figure 4E). Wound healing assays also showed that GSTM5 overexpression retarded the healing rate (Figure 4F) (Video S1). GSTM5 overexpression inhibited cell migration was also observed in BFTC 905 cells (Figure 4G). The results of the aforementioned functional assays indicate that GSTM5 plays a suppressor role in both bladder cancer proliferation and migration.

In the present study, GSTM5 was found to decrease cellular GSH levels and suppress cancer cell proliferation and migration. Therefore, to further elucidate whether GSH supplementation could restore cell proliferation and migration ability, 5637ovGSTM5 cells were treated with 4 mM GSH-M. Restoration of GSH levels was confirmed 24 h after GSH-M treatment (Figure 5A) and reversed the retardation of 5637ovGSTM5 cell proliferation (Figure 5B). In addition, the migration ability of 5637ovGSTM5 cells was significantly increased after GSH-M treatment (Figure 5C). Taken together, these data suggest that the GSTM5-induced suppression of cancer cell proliferation and migration were reversed by intracellular GSH supplementation.

BSO is an inhibitor of the glutamate-cysteine ligase catalytic subunit, which is the key enzyme for GSH biosynthesis. After treatment with 400 µM BSO for 24 h, intracellular GSH levels were decreased (Figure 6A), and proliferation was almost arrested (Figure 6B) in both 5637VC and 5637ovGSTM5 cells. Since 400 µM BSO had such a marked impact on proliferation after treatment for 2 days, a decreased dose of 40 µM was used for proliferation assay again (Figure 6C). Treatment with 40 µM BSO also significantly decreased the rates of 5637VC and 5637ovGSTM5 cell proliferation (Figure 6C). In cell migration assay, BSO significantly reduced cell migration capacity of 5637 and 5637VC cells, but not 5637ovGSTM5 cells because the migration ability of the latter was originally on the low side (Figure 6D).

Cell adhesion to the extracellular matrix is one of the important characteristics in tumor cell invasion [25]. Thus, this functional assay was performed to determine the effects of GSTM5 therein. Figure 7A shows that 5637ovGSTM5 cells exhibited a reduced ability of cell adhesion to fibronectin compared with 5637VC cells. This inhibition effect was also observed in RT4 (Figure 7B) and BFTC 905 cells (Figure 7C).

Overexpression of GSTM5 was found to decrease cancer cell proliferation and migration by decreasing cellular GSH levels. Therefore, we want to know whether cancer cells overexpressing GSTM5 induce resistance to anticancer drugs or not. The results indicated that the drug sensitivity of 5637ovGSTM5 in response to cisplatin and mitomycin C was not altered and that sensitivity to doxorubicin was marginally decreased (Figure 8A). In addition, the drug sensitivity was also analyzed in RT4 and BFTC 905 cells. It indicated that no obvious change between vector control-transfected and GSTM5 overexpressing RT4 (Figure 8B) and BFTC 905 (Figure 8C) cells. These findings suggest that overexpression of GSTM5 protein did not affect the susceptibility of bladder cancer cells to cisplatin and mitomycin C, which are commonly used anticancer drugs for bladder cancer treatment.

Bladder tumor samples (n = 50) from patients with bladder cancer and urine pellets (n = 50) from nonbladder cancer subjects were collected. All subjects gave their informed consent for inclusion before sample collection. The study was conducted in accordance with the Declaration of Helsinki 2013, and the study protocol was reviewed and approved by the institutional review board (IRB) of Ditmanson Medical Foundation Chiayi Christian Hospital (Chiayi, Taiwan). The approval number is CYCH-IRB 103070 (approved on 5 Jan 2015). DNA extraction of bladder tumor samples, urine pellets and culture cells followed the instructions of the DNA extraction kit (Geno Plus Genomic DNA extraction miniprep system, Viogene, New Taipei City, Taiwan).

Bisulfite conversion was performed using the EZ DNA methylation-gold kit (Zymo Research, Irvine, CA, USA). Five hundred nanograms of genomic DNA was reacted with sodium bisulfite following the kit instructions. After bisulfite conversion, the selected GSTM5 DNA promoter region was PCR amplified using bisulfite-specific primers: 5′- TTTAGGGYGGGTTGGGGAAGTTGG -3′ (forward) and 5′- AAAAAAAACRATCCCTAAAACCAATCCTACAACTAC -3′ (reverse), which amplified −209 to 198 bp of the human GSTM5 gene (amplicon size 407 bp). Next, the PCR products were subcloned into the T&A cloning vectors, which were transformed into competent cells. To determine the CpG methylation status of the 5′ CpG island of GSTM5, 10 clones of each sample were randomly picked for sequencing.

Three human bladder cancer cell lines, RT4, BFTC 905 and 5637, were purchased from Bioresource Collection and Research Center (Hsinchu, Taiwan). RT4 cells were cultured in McCoy’s 5a medium with 10% fetal bovine serum, 1% penicillin and 1% streptomycin, BFTC 905 and 5637 cells were cultured in RPMI 1640 medium with the same additional agents [24]. After washing the cells with PBS and lysing the cells with TRIzol reagent (Thermo Fisher Scientific, Waltham, MA, USA), total RNA was extracted according to the manufacturer’s instructions. Reverse transcription (RT) was performed on 2 μg of total RNA by 1.5 μM random hexamer and RevertAid™ reverse transcriptase (Fermentas, Waltham, MA, USA). Then, 1/20 volume of the reaction mixture was used for PCR with human GSTM5-specific primers (5′ ATGCCCATGACACTGGGGTACTG 3′, 5′ CCATGTGGTTATCCATAACCTGG 3′, product size 328 bp) and GAPDH-specific primers (5′CAAGGTCATCCATGACAACTTTG3′, 5′GTCCACCACCCTGTTGCTGTAG3′, product size 496 bp). The PCR products were analyzed by 1–2% agarose gel electrophoresis.

Total lysates of 5637 cells, empty vector-transfected 5637 cells (5637VC), and GSTM5-overexpressed 5637 cells (5637ovGSTM5) were extracted by PRO-PREP protein extraction solution (iNtRON Biotechnology, Burlington, MA, USA). Equal amounts of protein (30 μg) were separated by 8% SDS-polyacrylamide gels electrophoresis and transferred to polyvinylidene difluoride membranes. Immunodetection was performed using antibodies against human GSTM1~5 (GTX100298, GTX47111, GTX65535, GTX32637, GTX108776, GeneTex, Irvine, CA, USA), against GSTM5 (H00002949-D01P, Abnova, Taipei, Taiwan) and against β-actin (A5441, Sigma-Aldrich, St. Louis, MO, USA) as an internal control. Mouse or rabbit IgG antibodies coupled to horseradish peroxidase (Jackson ImmunoResearch, West Grove, PA, USA) were used as the secondary antibodies. Protein expression was visualized by Luminol/Enhancer solution (Thermo Scientific, Waltham, MA, USA) and a luminescence detector.

GSTM1~5 expression vectors were purchased from Origene, Rockville, MD, USA (RC223332, RC210718, RC201013, RC202097, RC208900) with Myc-DDK tagged. A total of 5637 cells were cultured in a 6-well plate with a density of 3 × 10⁵ cells/well and transfected the next day. The transfection reagent was PolyJet in vitro DNA transfection reagent (SignaGen Laboratories, Frederick, MD, USA) in the combination of 1 µg plasmid DNA and 3 µL PolyJet. After incubation for 6 h, the transfection medium was replaced by a fresh medium without DNA and PolyJet. For stable clone selection, the transfected cells were subcultured in 10 cm dishes with 800 µg/mL antibiotic G418 (GoldBio, St Louis, MO, USA). After 5 days, single colonies were picked up individually and seeded into a 24-well plate for amplification. The stable transfection cell lines were kept in a culture medium with 400 µg/mL G418.

Cells were cultured in 10 cm dishes with 80% confluence for transfection. The GSTM5 expression vector with Myc-DDK tagged and control vector was from Origene. Cells in one dish were incubated with the combination of 5 µg plasmid DNA and 15 µL PolyJet. After incubation for 24 h, the cells were collected for GSH level assay (6 × 10⁵ cells/sample) and seeded in the density of 6 × 10⁴ cells/Transwell/24-well for migration assay, 2 × 10⁴ cells/well/96-well for fibronectin adhesion assay, 3 × 10⁴ cells/well/24-well (BFTC 905) or 6 × 10⁴ cells/well/24-well (RT4) for drug cytotoxicity assay

The detection method of GST activity was modified from a GST activity assay kit from Cayman Chemical, Ann Arbor, MI, USA (item no. 703,302). After cell transfection for 24 h, cells were collected in GST store buffer (100 mM KH₂PO₄ (J.T.Baker, Radnor, PA, USA), 2 mM EDTA (Thermo Fisher Scientific)) and sonicated on ice. After centrifugation at 10,000× g for 10 min, 4 ℃, then the supernatant was further centrifuged at 100,000× g for 1 h, 4 ℃. The supernatant (cytosol fraction) was analyzed for GST activity in a 96-well plate. Twenty µL supernatant was added into a well with assay buffer (75 mM KH₂PO₄ (J.T.Baker), 0.075% Triton X-100 (J.T.Baker), 2 mM L-glutathione-reduced form (Alfa Aesar, Haverhill, MA, USA) on ice. After adding substrate 1-chloro-2,4-dinitrobenzene (CDNB) (Alfa Aesar) and mixing well, the OD340 nm values were read by a spectrophotometer at 25 ℃ for 20 min with 1 min interval. GST activity was calculated as [(OD340/min)/0.00503 µM⁻¹] × [0.2 mL/0.02 mL] = nmol/min/mL, then divided by protein concentration (mg/mL) to get the final GST activity (nmol/min/mg).

The detection of intracellular glutathione levels was using a glutathione assay kit (Cayman Chemical item no. 703,002) or a modified method from this kit. For the kit assay, one-well cells of a 6-well plate were collected with 1 mL of cell homogenization buffer (50 mM 2-(N-morpholino)ethanesulfonic acid (MES) (Sigma-Aldrich), 1 mM EDTA, pH 6.0) and sonicated on ice. In the modified assay, two 6 cm plates of cells were collected with 0.5 mL of the same cell homogenization buffer and sonicated on ice. After centrifugation at 10,000× g at 4 °C for 15 min, the supernatant was collected in a 1.5 mL tube. The cell supernatants were mixed with 5% metaphosphoric acid (MPA) (Sigma-Aldrich) for 5 min for deproteination and then centrifuged at RT for 5 min. One milliliter of supernatant was mixed with 50 µL of 4 M triethanolamine (Sigma-Aldrich) for pH adjustment. GSH standards (1000, 500, 250, 125, 62.5, 31.25 and 15.625 µM) with serial dilutions were prepared for making standard curve plots. Next, 150 μL of cocktail reagent (0.1 M MES, 0.025 M phosphoric acid, 0.5 mM EDTA, 20 µM 5,5′-dithiobis(2-nitrobenzoic acid) (DTNB) (Sigma-Aldrich)) and 50 μL of sample/standard were added to 96-well plates. After the 96-well plate was incubated at room temperature for 25 min, the absorbance was read at 405 nm. For supplementation of cellular GSH, glutathione-reduced ethyl ester (GSH-M, Sigma-Aldrich) was added to the cell medium for 24 h before assay.

Bladder cancer cells were seeded in 12-well plates at 6000 cells per well in RPMI-1640 medium with 400 µg/mL G418. The medium with or without 4 mM GSH-M, or 40 µM buthionine sulfoximine (BSO) (Sigma-Aldrich), was changed every day. Cells were trypsinized and counted using a hemocytometer every day.

Before cell seeding, each well was covered with 0.5% agarose (Uni-Onward, New Taipei City, Taiwan) at 37 ℃ for 30 min. Bladder cancer cells (2 × 10⁴ cells/well) were seeded into six-well culture plates in 0.3% agarose and incubated for 2 weeks to allow colony formation. The medium (2 mL/well) was changed every 3 days. The number of colonies from three independent experiments was counted using ImageJ, version 1.48 (NIH, Bethesda, MD, USA).

Migration assays were performed using 24-well Transwell chambers with 8 µm pore membrane (Wuxi NEST Biotechnology, Wuxi, Jiangsu, China). Bladder cancer cells were seeded in the upper chamber at 3 × 10⁴ cells/well (5637) or 6 × 10⁴ cells/well (BFTC 905) in 0.1 mL of RPMI 1640 serum-free medium. Medium with 10% FBS was placed in the bottom well (0.5 mL/well). After incubation for 24 h at 37 °C in an atmosphere containing 5% CO₂, the medium was discarded. Then cells were fixed in 4% formaldehyde (Sigma-Aldrich) at room temperature for 2 min, and then in methanol for 15 min. After PBS wash, cells were stained with 0.5% crystal violet (Sigma-Aldrich) for 5 min. After PBS wash, cells on the inside surface of the Transwell were removed by a cotton swab. The chambers were photographed, and stained cells were dissolved with DMSO for 10 min and then detected for the OD at 580 nm.

Cells were seeded in 6-well plates. After the cells reached confluence, a wound was made with a 200-µL plastic tip in each well. The wells were then washed twice with PBS to remove cell debris and then incubated with a culture medium. The wound areas were automatically monitored for 24 h by taking a photograph every 30 min in an augmented microscope (Lionheart, BioTek, Winooski, VT, USA). The wound areas were automatically analyzed by computer, and the wound healing curve was performed based on the area change over time. The wound area of each condition was presented as 100 at the beginning. The values are the mean of four wounds in each well.

The 96-well plates were precoated with fibronectin (5 µg/cm²) (Corning, corning, NY, USA) at 37 °C for 2 h. A total of 8 × 10³ cells/well (5637) or 2 × 10⁴ cells/well (BFTC 905) or 8 × 10³ cells/well (RT4) in serum-free RPMI 1640 were seeded into each well and incubated at 37 °C for 2 h (5636) or 3.5 h (BFTC 905 and RT4). After incubation, nonattached cells were washed out by PBS, and then attached cells were fixed in 4% formaldehyde at room temperature for 30 min. Subsequently, cells were stained with 0.5% crystal violet for 1 min. After PBS wash, the plate was photographed, and cells were dissolved in DMSO. The absorbance at 580 nm was detected.

Cell viability was detected by the MTT assay. The 5637 cells were seeded at 3 × 10⁴ cells/well into 24-well plates for 24 h and then treated with doxorubicin (Sigma-Aldrich) for 24 h or treated with mitomycin C (Sigma-Aldrich) or cisplatin (Sigma-Aldrich) for 48 h. Twenty-five microliters of MTT (50 mg/mL) (AK Scientific, Union City, CA, USA) was added to each well and incubated for 90 min in a 5% CO₂ incubator. After incubation, discarded the medium and 500 µL of DMSO was added to each well and mixed well by micropipette. One hundred microliters of the suspension were transferred to a 96-well plate, and the OD values were read at 595 nm.

Statistical differences were analyzed by one-way analysis of variance followed by Student’s t-test. The statistics in human samples were analyzed by SPSS for Windows version 21.0 (IBM Corp., Armonk, NY, USA) except noted in the figure legend. All statistics in the cell line assay were calculated using GraphPad Prism software, version 5.0 (GraphPad Prism software, La Jolla, CA, USA). Numerical data are expressed as the mean ± standard error (SE) from three independent experiments.

The data and materials used in the current study are available from the corresponding author on reasonable request.