Asrij/OCIAD1 may increase age-related brain immune cell activation and inflammation in mice

Generation and validation of the asrij floxed and KO mice have been described previously (Sinha et al., 2019). To generate constitutive whole-body asrij KO mice, homozygous asrij floxed (asrij^flox/flox) mice were bred with hemizygous CMV-Cre⁺ (Strain #006054) mice to obtain heterozygous asrij KO mice (asrij^+/flox; CMV-Cre⁺). These were then crossed with homozygous asrij floxed mice to generate homozygous asrij KO mice (asrij^−/−; CMV-Cre⁺). For genetic identification of floxed and KO mice, DNA was isolated from tail clippings using a crude NaOH extraction protocol. Genotyping PCR was performed using the primers Arj_F1 (5′- GGAGAATTGCGGCGCTCTTCTCC -3′) and Arj_R1 (5′- CCATCCATCCCTCTCCACTGG −3′) to amplify the wild-type locus (608 bp) and the floxed locus (681 bp), and primers Arj_F2 (5′- ATGAAGCAGTGTCTTGGGATTGC -3′) and Arj_R1 (5′- CCATCCATCCCTCTCCACTGG −3′) to detect the excised copy (535 bp). Young (4-month-old) and aged (24-month-old) asrij floxed and KO mice were bred separately as homozygous stocks for all experiments. Age-matched male mice were used in this study. Mice were maintained at the Jawaharlal Nehru Centre for Advanced Scientific Research (JNCASR) animal facility in an individually ventilated cage (IVC) system under ambient temperature (23 ± 1.5 °C), a 12-h light–dark cycle, and with ad libitum standard rodent chow diet and water. Mice were euthanized using cervical dislocation. All mouse experiments and protocols were approved by the JNCASR Institutional Animal Ethics Committee (Project #MSI005) and conducted in compliance with the guidelines and regulations.

Mouse N9 microglial cells were cultured in DMEM (Gibco, Thermo Fischer Scientific, USA; #12800–017) containing 1X GlutaMAX (Gibco, Thermo Fischer Scientific, USA; #35050–061) and 10% Fetal Bovine Serum (Gibco, Thermo Fischer Scientific, USA; #1010270106) at 37 °C in a humidified 5% CO₂ incubator. For the in vitro LPS treatment, 2 × 10⁵ cells were plated and cultured overnight. The next day, microglia were stimulated with 100, 250, and 500 ng/mL LPS (Sigma-Aldrich, USA; #L2630) for 12 h at 37 °C and then harvested for lysate preparation and immunoblotting.

Aged (24-month-old) asrij floxed and KO mice were intraperitoneally injected with 0.5 mg/kg LPS (Sigma-Aldrich, USA; #L2630) or saline as per the previously published procedure (Cheng et al., 2021). Whole brains were collected 24 h after the injection. The left hemisphere was processed for cryosectioning and immunofluorescence, while the right hemisphere was used for qPCR and immunoblotting.

Processing of the mouse brain samples and immunohistochemistry were performed as described previously (Dongre et al., 2025). Mice were euthanized by cervical dislocation, and their brains were rapidly isolated and bisected. The left hemisphere was fixed with 4% paraformaldehyde (PFA) at 4 °C for 48 h. Hippocampi and cortices from the right hemisphere were micro-dissected and flash-frozen at −80 °C for protein and RNA extraction. Fixed hemibrains were cryoprotected in 30% sucrose at 4 °C for 48 h, embedded in PolyFreeze medium (Sigma-Aldrich, USA; #SHH0026), and sectioned coronally (30 μm) using a cryostat (Leica, #CM3050S). Sections were collected on 0.3% gelatin-coated slides and stored at −80 °C. For immunofluorescence, the slides were thawed to room temperature (RT), washed with PBS + 0.05% sodium azide, and permeabilized in 0.3% Triton X-100 (Sigma-Aldrich, USA; T8787) for 1 h at RT. Sections were blocked with 4% FBS (Gibco, Thermo Scientific, USA; #1010270106) for 1 h at RT and then incubated overnight at 4 °C with the following primary antibodies: GFAP (Cloud Clone Corporation, USA; #PAA068Mu02) and IBA1 (Cell Signaling Technology, USA; #17198S). After washing, the sections were incubated for 1 h at RT with Alexa Fluor 488 conjugated anti-rabbit secondary antibody (1,400, Invitrogen, USA, #A-11008), washed again, and mounted with ProLong Gold Antifade containing DAPI (Roche, Switzerland; #P36930).

Hippocampal and cortical regions were imaged using a Zeiss LSM 880 confocal microscope (Zeiss, Germany) with 20 × and 63 × objectives at 0.5 μm z-intervals. For quantification, 20 × images were acquired from three serial sections per mouse, with four to five images per section for each region. Images were processed in Fiji/ImageJ (NIH, MD, USA), converted to 8-bit, background subtracted (rolling-ball radius, 50 pixels), and thresholded to calculate the percentage staining area. Cell numbers were quantified using the "Analyze Particle" Function. For morphological analysis of microglia and astrocytes, 63 × images were exported to Imaris (Oxford Instruments, UK) and skeletonized using the 'Filament' module. At least 20–25 cells per section (three sections per mouse) were analyzed. Representative images are shown as maximum intensity projections.

Preparation of lysates and western blotting was performed as described previously (Dongre et al., 2025). Frozen hemibrains were homogenized in 500 μL lysis buffer [20 mM HEPES (pH 7.5), 150 mM NaCl, 5 mM MgCl₂, 5 mM EDTA (pH 8), 0.5% Triton X-100, 10% glycerol, 5 mM DTT, 1 mM PMSF, 10 mM NaF, 1 mM Na₃VO₄, and protease inhibitors (Sigma-Aldrich, USA)] using a tissue tearor. Lysis was performed for 4 h at 4 °C and then centrifuged at 16,000 rcf for 30 min at 4 °C. Supernatants were stored at −80 °C, and protein concentrations were measured using the Bradford assay (Bio-Rad, USA). Equal protein amounts (40 μg) were denatured in Laemmli buffer at 99 °C for 5–10 min, separated using 10–12% SDS-PAGE, and transferred to nitrocellulose membranes. Membranes were blocked with 5% skim milk in PBST (PBS + 0.1% Tween 20) for 1 h at room temperature (RT), then incubated overnight at 4 °C with primary antibodies against Asrij/OCIAD1 (Abcam; #ab91574), IBA1 (#17198S), STAT3 (#9139S), p-STAT3 (Tyr705) (#9145S), NF-κB p65 (#8242S), p-NF-κB p65 (Ser536) (#3033S), TNF-α (#11948S), IL-6 (#12912S) (all from Cell Signaling Technology, USA), Glyceraldehyde-3-Phosphate Dehydrogenase (GAPDH, #G9545), and α-tubulin (#T8203) (both from Sigma-Aldrich). After washing, the membranes were incubated with HRP-conjugated anti-rabbit or anti-mouse secondary antibodies (GeNei Laboratories, India) for 1 h at RT, developed with Clarity ECL reagent (Bio-Rad, USA; #1705061), and visualized on X-ray films. Band intensities were quantified in Fiji and normalized to the loading controls.

100 μg protein from hippocampal and cortical lysates was used to measure the levels of cytokines, IL-6, and TNF-α. BD OptEIA mouse IL-6 (#550950) and BD OptEIA TNF-α (#560478) (both from BD Biosciences, CA, USA) ELISA kits were used, according to the manufacturer's instructions. Absorbance was measured using a Varioskan LUX multimode microplate reader (Thermo Fisher Scientific, MA, USA). A standard curve was generated using known concentrations and fitting a sigmoidal curve in Prism 9.0 (GraphPad, USA). The concentration of the samples was obtained by interpolation. The assay was performed in duplicate per sample for three independent biological replicates.

RNA isolation from the brain and RT-qPCR were performed as described previously (Dongre et al., 2025). Briefly, the hippocampus and cortex tissues were minced and homogenized in 1 mL ice-cold TRIzol reagent (Invitrogen, CA, USA; #15596–026). RNA isolation was performed according to the manufacturer's instructions. cDNA was synthesized using 2 μg total RNA in the SuperScript III First-Strand Synthesis Kit (Invitrogen, USA; #18080051). RT-qPCR was performed using the SensiFAST SYBR No-ROX kit (Bioline/Meridian Life Sciences, USA; # BIO-98020) in a CFX384 real-time PCR system (Bio-Rad, USA), according to the manufacturer's protocol. All reactions were performed in duplicate, and GAPDH was used as a loading control. Relative transcript levels were calculated and normalized using the 2^−ΔΔCT method. The following primers were used: iNos2 (Forward: CCCTCCTGATCTTGTGTTGGA, Reverse: CAACCCGAGCTCCTGGAA), IL-1β (Forward: CACAGCAGCACATCAACAAG, Reverse: GTGCTCATGTCCTCATCCTG), IL-18 (Forward: GACAGCCTGTGTTCGAGGATATG, Reverse: TGTTCTTACAGGAGAGGGTAGAC), TNF-α (Forward: GCCTCTTCTCATTCCTGCTTG, Reverse: CTGATGAGAGGGAGGCCATT), NF-κB (Forward: GCTGCCAAAGAAGGACACGACA, Reverse: GGCAGGCTATTGCTCATCACAG), Nlrp3 (Forward: AGAAGCTGGGGTTGGTGAATT, Reverse: GTTGTCTAACTCCAGCATCTG), C3 (Forward: AGCTTCAGGGTCCCAGCTAC, Reverse: GCTGGAATCTTGATGGAGACGC), C1qbp (Forward: CCACGCAACGGCAAGTTCAC, Reverse: CGGCCACGAACGAGATTCAC), P2ry12 (Forward: AAACTCGGGCCGTCTTTGA, Reverse: GACGTCAGCCATAGGGTGCT), Tmem119 (Forward: ACTACCCATCCTCGTTCCCTGA, Reverse: TAGCAGCCAGAATGTCAGCCTG), Cx3cr1 (Forward: CTGTTATTTGGGCGACATTG, Reverse: AACAGATTTCCCACCAGACC), Trem2 (Forward: CTGCTGATCACAGCCCTGTCCCAA, Reverse: CCCCCAGTGCTTCAAGGCGTCATA), Apoe (Forward: GAACCGCTTCTGGGATTACCTG, Reverse: GCCTTTACTTCCGTCATAGTGTC), Itgax (Forward: ATCCTTGTCTACCCCAGTGC, Reverse: CATCCAGGGCTAGCTGAAG), Clec7a (Forward: CCAGCTAGGTGCTCATCTACTG, Reverse: CCTTCACTCTGATTGCGGGAAAG), Axl (Forward: GGAGGAGCCTGAGGACAAAGC, Reverse: TACAGCATCTTGAAGCCAGAGTAGG), Arg1 (Forward: GGAGACCACAGTCTGGCAGTTGGA, Reverse: GGACACAGGTTGCCCATGCAGA), Il10 (Forward: CCCTTTGCTATGGTGTCCTT, Reverse: TGGTTTCTCTTCCCAAGACC), Vimentin (Forward: CGGAAAGTGGAATCCTTGCAGG, Reverse: AGCAGTGAGGTCAGGCTTGGAA), Lipocalin 2 (Forward: ATGTCACCTCCATCCTGGTCAG, Reverse: GCCACTTGCACATTGTAGCTCTG), S100a10 (Forward: GAAAGGGAGTTCCCTGGGTT, Reverse: CCCACTTTTCCATCTCGGCA), Eaat1 (Forward: CGGGATTCCTCAGGCCGGTC, Reverse: GTTCGGAGGCGGTCCAGAAACC) and Serpina3n (Forward: CAACCAGAGACCCTGAGGAAGT, Reverse: AGGACATCCTCCAGGCTGTAGT).

Each data point in the graphs corresponds to an individual mouse. All data are expressed as mean ± standard error of the mean (SEM). Statistical significance between two groups was assessed using an unpaired two-tailed Student's t-test. For comparisons involving more than two groups, two-way analysis of variance (ANOVA) was performed, followed by Tukey's multiple comparison post-hoc test. All statistical analyses and graph generation were conducted using the Prism 10 software (GraphPad). A p-value of less than 0.05 was considered statistically significant. The following notation was used to indicate significance levels: ns— not significant, *p < 0.05, **p < 0.01, and ***p < 0.001.

Heightened neuroinflammation is a central feature of brain aging, attributed to activated microglia and astrocytes (Edler et al., 2021). Increased Asrij protein levels in the brain are apparent in aged (18-month-old) WT mice (Li et al., 2020). This correlates with the increased numbers of glia and neuroinflammation in the aged WT mice. Given that Asrij promotes microglial activation and neuroinflammation in AD, we investigated whether it plays a similar role in normal aging.

To investigate whether Asrij impacts the maintenance of glia in the brain during normal aging, we used young (4-month-old) and aged (24-month-old) asrij floxed (control) and asrij KO mice. Immunostaining of brain cryosections showed increased numbers of IBA1⁺ microglia in aged asrij floxed mice than in the young asrij floxed mice. This finding is in agreement with the previous reports that support age-associated increases in microglial coverage in mice (Niraula et al., 2017). Young asrij KO mice did not exhibit changes in microglial numbers compared to young floxed mice. Interestingly, aged KO mice showed reduced microglia in the hippocampus and cortex compared to the aged control mice (Figure 1A). However, Imaris-based analysis of microglial morphology revealed no significant differences in branch length and branch number due to Asrij depletion in aged mice (Figure 1B). Thus, Asrij may be essential to maintain microglial numbers but not morphology in the aged mice.

One of the key aging-associated changes in the brain is the phenotypic shift of astrocytes to a neuroinflammatory A1-like reactive state, which is marked by increased GFAP levels (Clarke et al., 2018; Habib et al., 2020; Patani et al., 2023). As expected, we observed increased GFAP coverage in the aged control mice compared to the young control mice, indicating age-associated astrocyte activation. Young asrij KO mice showed equivalent levels of GFAP staining compared to young control mice. Interestingly, aged asrij KO mice had decreased GFAP coverage compared to aged control mice, indicating that Asrij contributes to age-related astrocyte activation (Figure 1C). Astrocyte activation is accompanied by a transition from a stellate morphology that marks the resting or homeostatic state to a hypertrophic morphology marking the reactive state (Liddelow and Barres, 2017). Hence, we also evaluated astrocyte morphology using the 'filament' tool of Imaris. While aged control mice displayed astrocytes with numerous branches, asrij KO mice exhibited reduced astrocytic branch number and branch length, suggesting decreased activation (Figure 1D).

Transcriptomic analysis of microglia and astrocytes from young and aged mice has revealed several gene expression signatures of activation (Paolicelli et al., 2022; Patani et al., 2023). Notably, aged glia show alterations in gene modules associated with tissue repair, inflammation, synaptic functions, and metabolism, among others (Candlish and Hefendehl, 2021). We used RT-qPCR to assess the expression of markers linked to microglial and astroglial activation in aged asrij KO mice. Aged asrij KO mice showed increased levels of homeostatic microglial markers (P2ry12, Tmem119, and Cx3cr1) and a concomitant increase in Disease-Associated Microglia (DAM) markers such as Clec7a, Axl, Apoe, and Itgax (Figure 1E). Similarly, aged asrij KO mice had reduced levels of astrocyte activation markers such as Lipocalin 2, S100a10, and Serpina3n (Figure 1F). Thus, our RT-qPCR analysis is in agreement with the imaging studies and further strengthens the findings that loss of Asrij attenuates glial activation in the aged mouse brain.

A consequence of glial activation in the aged brain is the exaggerated production of pro-inflammatory mediators, such as cytokines and chemokines, in the brain milieu. Such hyperactive immune responses contribute to age-related neuropathology and cognitive defects in rodents (Candlish and Hefendehl, 2021; Deng et al., 2023). Given that asrij depletion led to reduced glial activation, we assessed the pro-inflammatory gene expression in the aged brain using RT-qPCR. Interestingly, there was a significant downregulation of pro-inflammatory genes, namely inducible nitric oxide synthase (iNos2), interleukin-1 beta (IL-1β), tumor necrosis factor (TNF-α), NOD-, LRR-, and pyrin domain-containing protein 3 (Nlrp3), and complement factors C3 and C1qbp in the aged asrij KO brain (Figure 2A). We also measured the levels of two key pro-inflammatory cytokines, TNF-α and IL-6, using enzyme-linked immunosorbent assay (ELISA). Young KO mouse brains had normal levels of TNF-α and IL-6 compared to those of young floxed mice (Figure 2B). As expected, aged control mice showed elevated levels of IL-6 and TNF-α in hippocampal and cortical homogenates compared to young control mice. While there was an increase in levels of IL-6 and TNF-α upon aging in the KO brains, this was not to the same extent as that in control aged brains (Figure 2B). This suggests that the increase in Asrij levels during normal aging may promote or sustain the proinflammatory state of the aged brain. Furthermore, while Asrij depletion can partially reduce the levels of pro-inflammatory cytokines, restoring them to the levels seen in young mice may depend on additional factors.

Several signaling pathways, such as NF-kB, STAT3, PI3K-Akt, NLRP3 inflammasome, and cGAS-STING, mediate neuroinflammation in the brain. Asrij promotes STAT3 and NF-κB activation in microglia to promote neuroinflammation in AD (Dongre et al., 2025). Hence, we checked the status of IL-6/STAT3 and TNF-α/NF-κB signaling pathways in the brains of aged asrij KO mice. Immunoblotting analyses showed a decline in the levels of TNF-α and phospho-NF-kB (Ser536), indicating attenuated NF-κB activation in the KO hippocampus and cortex (Figure 2C). Reduced levels of IL-6 and phospho-STAT3 (Tyr705) were also observed, suggesting decreased STAT3 activation (Figure 2D). Thus, the loss of Asrij attenuates the activation of signaling effectors known to propagate neuroinflammation in the aged mouse brain.

Healthy aging is characterized by increased neuroinflammatory "priming," wherein a peripheral immune stimulus causes an exaggerated release of pro-inflammatory cytokines in the brain. This is largely ascribed to functional alterations in microglia, which are the main sources of inflammatory molecules (Norden and Godbout, 2013; Perry and Holmes, 2014). As Asrij depletion diminished the basal neuroinflammatory state, we evaluated the potential role of Asrij in controlling neuroinflammatory priming. To this end, we used an acute in vivo LPS injection model, which is widely used to study responses to neuroinflammation. We first evaluated the status of Asrij expression in the brain and microglia upon LPS challenge. Immunoblotting analyses showed increased Asrij protein levels in the hippocampus and cortex of LPS-treated aged asrij floxed mice (Figure 3A). A publicly available bulk RNA sequencing dataset showed increased Asrij transcript levels in sorted microglia upon LPS treatment (Srinivasan et al., 2016) (Figure 3B). Furthermore, increased Asrij protein levels were detected upon LPS stimulation of the N9 mouse microglial cell line (Figure 3C). This confirms that Asrij levels are elevated in the mouse brain and microglia in response to LPS.

Next, we assessed the impact of Asrij depletion on LPS-induced microglial activation and neuroinflammation (Figure 4A). In control (floxed) mice, intraperitoneal LPS administration caused an increase in microglial number, indicating microglial proliferation. In contrast, KO mice injected with LPS showed no difference in microglial numbers (Figure 4B). Microglial morphology is a standard indicator of activation state. Homeostatic/resting microglia display ramified morphology with long and thin branches. Activated microglia show a 'bushy' or 'amoeboid' morphology. LPS-treated floxed mice showed an increased proportion of bushy and amoeboid microglia. Interestingly, KO mice had a significantly reduced fraction of activated microglia (Figure 4C). Additionally, Imaris-based filament analysis showed reduced microglial branch number and length upon LPS treatment in control mice. KO microglia failed to undergo morphological transition in response to LPS (Figure 4D). Collectively, these results demonstrate that asrij knockout impedes LPS-induced microglial activation in aged mice.

LPS induces the activation of several inflammatory signaling cascades that lead to transcriptional upregulation of inflammatory genes (Jung et al., 2023). To probe the impact of Asrij depletion on pro-inflammatory gene expression, RT-qPCR analysis was performed. Asrij knockout significantly inhibited LPS-induced upregulation of iNos2, Nlrp3, IL-1β, IL-18, C3, and C1qbp (Figure 4E). Furthermore, ELISA revealed that KO mice failed to show an increase in the levels of TNF-α and IL-6 upon LPS injection, as observed in the control mice (Figure 4F). KO mice also did not exhibit increased levels of IBA1 or phosphorylated NF-κB in response to LPS, further confirming a dampened neuroinflammatory response (Figure 4G). Taken together, our results suggest that Asrij may be required for LPS-induced neuroinflammation.