How RNA interactions may contribute to heart inflammation after COVID-19 mRNA vaccines and what this means for future vaccine design

AC16 human cardiomyocytes were kindly provided by Wuhan Pricella Biotechnology Co., Ltd (Wuhan, China). Cells were cultured in DMEM/F12 medium (Procell, Wuhan, China) supplemented with 10% (v/v) fetal bovine serum (FBS; Procell, Wuhan, China), and maintained at 37 °C in a 5% CO₂-enriched humidified environment.

The pmRVac-Spike UTR plasmid was constructed by VectorBuilder Biotechnology (Guangzhou, China) using Gibson assembly technology. The mRNA sequence of the BNT162b2 COVID-19 mRNA vaccine produced by Pfizer-Biotech has been disclosed (23).

The SARS-CoV-2 spike glycoprotein coding sequence was inserted into the pmRVac vector using Gibson assembly to generate a DNA template for in vitro transcription (IVT). The pmRVac vector contains a T7 promoter sequence, a 5' UTR, a 3' UTR, a 110 nt segmented poly(A) tail and a SapI restriction enzyme site used for run-off transcription. The insertion site of SARS-CoV-2 spike glycoprotein coding sequence was between the UTRs. The Gibson Assembly reaction product was transformed into E. coli and plated on LB containing 50 μg/mL kanamycin. The resulting colonies were screened by PCR to identify positive insertion events. The PCR positive clones were evaluated further by restriction digestion and Sanger sequencing. The correct plasmid was cultured in LB media and purified using an Endotoxin-Free Plasmid Midiprep Kit (Sigma-Aldrich, Burlington, MA, USA). Plasmid DNA concentration and purity were measured on a UV-Vis spectrophotometer, and then linearized using SapI restriction enzyme.

To produce uncapped in vitro RNA transcripts, linear DNA template was mixed with T7 RNA polymerase, nucleotide triphosphates (NTPs) and magnesium-containing buffer to set up the in vitro transcription reaction. The reaction mixture was incubated at 37 °C for 2 hours. In the process of in vitro transcription, the natural uridine was replaced with N1-methylpseuduridine (m1Ψ). Cap1 mRNA was produced using vaccinia capping system. After denaturation of uncapped transcripts by heating, vaccinia capping enzyme, 2'-O methyltransferase, GTP, S-adenosyl methionine (SAM) and capping buffer were added to set up the capping reaction. The reaction mixture was incubated at 37 °C for 1 hour. Subsequently, template DNA was removed by DNase I treatment. Capped transcripts were further purified using magnetic beads. The isolated mRNA was eluted with an acidic buffer and stored at −80 °C. The mRNA concentration and purity were measured on a UV-Vis spectrophotometer. The mRNA integrity was confirmed by denaturing agarose gel electrophoresis, and the sequence identity was verified via mRNA sequencing.

AC16 cardiomyocytes were seeded in 12-well plates 18–24 h prior to transfection. At 60–80% confluence, cells were transfected with IVT mRNA (0.1 μg/mL) using Lipo8000™ transfection reagent (Beyotime, Shanghai, China) as per the manufacturer's instructions. Cells were collected 24–48 h post-transfection for subsequent analyses.

AC16 cardiomyocytes were starved for 12 h when it reached 80% confluence. Subsequently, the cells were stimulated with LPS (Beyotime, Shanghai, China) at a final concentration of 10 µg/mL for 12 h to induce an inflammatory response in cardiomyocytes.

The level of cell apoptosis was measured using an Annexin V-PE/7-AAD Apoptosis Detection kit (Yeasen Biotechnology, Shanghai, China) according to the manufacturer's instructions. AC16 cardiomyocytes were cultured in 6-well plates. When the cells reached 70% confluence, AC16 cardiomyocytes were transfected with IVT mRNA (0.1 μg/mL). Approximately 48 h after transfection, the cells were collected and washed twice with pre-cooled PBS at 4 °C. The supernatant was discarded, and the cells were resuspended in 1× binding buffer containing 50 μL/mL Annexin V-PE and 100 μL/mL 7-AAD. The cells were gently mixed and incubated at room temperature (25 °C) for 15 min in the dark. Subsequently, the level of cell apoptosis was detected using a BD FACSCalibur (BD Biosciences, Franklin Lakes, NJ, USA), and the data was analyzed with FlowJo 10 (VX.0.7) software (Tree Star, Ashland, OR, USA). The experiment was repeated in triplicates.

Total RNA from AC16 cardiomyocytes was extracted using TRIzol™ Reagent (Invitrogen, Thermo Fisher Scientific, MA, USA) according to the manufacturer's protocol. The concentration of the extracted RNA was measured using a NanoDrop™ 8000 spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA). cDNA was synthesized using a Reverse Transcription Kit (Takara, Osaka, Japan). RT-qPCR was performed using a SYBR Green PCR Master Mix on a QuantStudio™ 6 Flex System (Applied Biosystems, Foster City, MA, USA). Primer specificity was determined by melting curve analysis. Relative gene expression levels were calculated using the 2^-ΔΔCt method. Primer efficiencies were confirmed to be between 90% and 110% using standard curve analysis, validating the use of the ΔΔCt method for relative quantification (Supplementary Figure S1). β-actin was used as the internal control for mRNAs expression, and the expression levels of mature microRNAs (miRNAs) were normalized to U6. The quantification of miRNAs was based upon the stem-loop RT primer approach using a miRNA-specific primer to convert miRNA into cDNA, which was then amplified by a pair of qPCR primers. The detailed stem-loop primer sequences used for the reverse transcription of miRNAs are as follows: miR-149-5p: GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACGGGAGT;

miR-98-5p: GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAACAAT; let-7a-5p: GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAACTAT;

let-7c-5p: GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAACCAT;

let-7f-5p: GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAACTAT.

The sequences of the primers used are listed in Table 1.

The Luminex liquid suspension chip was detected using the BioPlex protein array (Bio-Rad, Hercules, CA, USA) and the Luminex 200 detection system (Luminex Corporation, Austin, TX, USA) according to the manufacturers' specifications. Upon the confluence of AC16 cardiomyocytes reached 70%, the cells were transfected with IVT mRNA (0.1 μg/mL). Approximately 48 h after transfection, the medium was then changed to FBS-free DMEM/F12 for an additional 24 h. The cell supernatant was subsequently collected for inflammatory cytokine analysis. The experiment was repeated in triplicates.

The levels of Creatine Kinase-MB (CK-MB) and cardiac troponin I (cTN-I) in the supernatant of AC16 cardiomyocytes were measured using CK-MB (ml026270V; MLBio, Shanghai, China) and cTN-I ELISA kits (ml023547V; MLBio, Shanghai, China), respectively. Similarly, the interleukin-6 (IL-6) inflammatory cytokine content in the supernatant of AC16 cell cultures was determined using a human-specific IL-6 ELISA kit (Beijing 4A Biotech Co., Ltd., Beijing, China). When AC16 cardiomyocytes reached 70% confluence, the cells were transfected with IVT mRNA (0.1 μg/mL) for 48 h, followed by a medium change to FBS-free DMEM/F12 for 24 h. The cell supernatant was then collected for inflammatory cytokine analysis. The experiment was repeated in triplicates.

RIP assays were performed using the Magna RIP™ RNA-Binding Protein Immunoprecipitation Kit (Millipore, <ns/>17-700, USA) according to the manufacturer's protocol. After the expansion of AC16 cardiomyocytes, the cells were collected and lysed in RIP lysis buffer containing RNase and protease inhibitors. The cell lysates were then incubated with rotation overnight at 4 °C with magnetic beads conjugated to 5 μg of rabbit anti-Ago2 (ab186733, Abcam, Cambridge, UK) and 5 μg of negative control rabbit IgG. On the following day, the beads were washed 10 times with wash buffer on the magnetic separator. The isolated RNA was then purified and precipitated, and the expression levels of target RNAs were subsequently determined by RT-qPCR. The experiment was repeated in triplicates.

The GV272 (SV40-firefly_Luciferase-MCS) plasmid was used to construct the IVT mRNA-3' UTR and IL-6 mRNA-3' UTR luciferase reporter gene plasmid (GENECHEM Biotech, Shanghai, China). Wild−type (Wt) and mutant (Mt) 3' UTRs of IVT mRNA and IL-6 mRNA were synthesized and cloned into the downstream sites of the GV272 vector (GENECHEM Biotech, Shanghai, China). AC16 cardiomyocytes were seeded into 12-well plates and co-transfected with Wt/Mt plasmids and miR-NC/miR-98-5p/let-7a-5p/let-7f-5p mimics (RiboBio, Guangzhou, China) using Lipo8000™ transfection reagent according to the manufacturer's protocol. After the incubation for 48 h, the cells were harvested and lysed, and relative luciferase activity was measured using a Dual Luciferase Reporter Gene Assay Kit (Beyotime, Shanghai, China) according to the manufacturer's protocol. The relative light units (RLU) of Firefly Luciferase and Renilla Luciferase of each sample were measured using a Centro LB 960 Microplate Luminometer (Berthold Technologies, Bad Wildbad, Germany). The RLU of Renilla Luciferase was used as an internal standard control. The relative luciferase activity of each sample was calculated as the RLU ratio of Firefly Luciferase/Renilla Luciferase. The experiment was repeated in triplicates.

1 × 10⁶ cells were utilized for copy number analysis. Absolute quantification was conducted using a series of 10-fold dilutions of the reference standard. The Ct values obtained from qPCR analysis were plotted against the dilution factors, and the data were fitted to a straight line. The copy numbers of IL-6 and let-7f-5p were determined based on the standard curve.

All experiments in this study were repeated in biological triplicates. Data are presented as the mean ± standard deviation (SD) and were analyzed using GraphPad Prism 9 software (GraphPad Software, San Diego, CA, USA). The Student's t-test was used to determine statistical significance between two groups, while a one-way analysis of variance (ANOVA) was applied for comparisons among three or more groups. A p-value < 0.05 was considered statistically significant. Significance levels were indicated as follows: p < 0.05 (*), p < 0.01 (**), p < 0.001 (***), and p < 0.0001 (****). "ns" represents no significant difference.

The sequence of the Pfizer-BioNTech COVID-19 mRNA vaccine (BNT162b2) has been previously disclosed (23). This 4284-nucleotide RNA construct comprises five key elements: 5'-cap, 5' UTR, SARS-CoV-2 spike glycoprotein coding sequence, 3' UTR, and poly(A) tail (Figures 1A, B).

To investigate the potential effects of IVT mRNA on inflammatory signaling in cardiomyocytes, we employed Luminex technology to quantify 21 inflammatory cytokines in AC16 cardiomyocyte supernatants. Cytokine levels were quantified (Figure 2A) and visualized as a heatmap (Figure 2B). Notably, IL-6 showed the most pronounced upregulation post-transfection. As a key mediator of the immune response, IL-6 is closely associated with various inflammatory diseases, including myocarditis (17, 18). ELISA results further validated the increase in IL-6 expression, consistent with Luminex chip results (Figure 2C). RT-qPCR experiments confirmed that IL-6 mRNA levels were significantly elevated in cardiomyocytes after IVT mRNA transfection (Figure 2D). Additionally, we induced an inflammatory response in the cells using LPS, and under inflammatory conditions, IVT mRNA further exacerbated IL-6 secretion (Figure 2D). To further explore the effects of IVT mRNA on AC16 cardiomyocyte function, we performed apoptosis assays. The results demonstrated that IVT mRNA transfection significantly promoted cardiomyocyte apoptosis. Furthermore, under LPS-induced inflammatory conditions, IVT mRNA exacerbated apoptosis in cardiomyocytes (Figures 2E, F). Following IVT mRNA transfection, there was a significant increase in the secretion of myocarditis markers CK-MB and cTn-I (Figures 2G, H). These findings indicated that IVT mRNA promoted the secretion of inflammatory cytokines and increased apoptosis in cardiomyocytes.

Given the enrichment of IVT mRNA in the cytoplasm, we hypothesized that it might function as a ceRNA to regulate IL-6 translation by sponging specific miRNAs implicated in the pathogenic process of myocarditis. To test this hypothesis, we employed three publicly available prediction tools—TargetScan, miRDB, and miRTarBase—to identify potential miRNAs that could bind to the IL-6 mRNA-3' UTR. These analyses predicted five candidate miRNAs (miR-149-5p, miR-98-5p, let-7a-5p, let-7c-5p, and let-7f-5p) with binding potential to the IL-6 mRNA-3' UTR (Figure 3A). Using the RNAhybrid database, we further confirmed that these miRNAs could also bind to the IVT mRNA-3' UTR. To experimentally validate these interactions, RNA immunoprecipitation (RIP) assays were performed in AC16 cardiomyocytes. The results demonstrated that miR-98-5p, let-7a-5p, let-7f-5p, IVT mRNA, and IL-6 mRNA were co-immunoprecipitated with an anti-Ago2 antibody (Figure 3B), suggesting functional interactions between IVT mRNA, IL-6 mRNA, and these miRNAs. Previous studies have demonstrated that hsa-let-7f-5p directly regulates IL-6 expression in radiation enteritis (24). RT-qPCR showed that let-7f-5p expression decreased after transfection with IVT mRNA (Figure 3C). To confirm this regulatory role, we constructed luciferase reporter vectors containing wild-type (Wt) or mutant (Mt) binding sites for let-7f-5p in the 3' UTRs of IVT mRNA and IL-6 mRNA (Figures 3D, F). Transfection of let-7f-5p mimics significantly reduced the luciferase activity of the wild-type IVT mRNA-3' UTR reporter in AC16 cardiomyocytes (Figure 3E). A similar reduction in luciferase activity was observed for the wild-type IL-6 mRNA-3' UTR reporter under the same conditions (Figure 3G). However, no significant changes in luciferase activity were detected when mutant IVT mRNA or IL-6 mRNA-3' UTR reporters were co-transfected with let-7f-5p mimic or a scrambled control miRNA. A fundamental requirement for investigating ceRNA mechanisms is that the copy numbers of mRNA and microRNA are comparable. To support the ceRNA hypothesis, we measured the copy numbers of IL-6 and let-7f-5p in AC16 cells using absolute quantification. The results revealed comparable copy numbers, with each AC16 cell containing approximately 83.70 copies of IL-6 and 62.27 copies of let-7f-5p (Figure 3H). Furthermore, RT-qPCR analysis demonstrated that IVT mRNA transfection significantly increased IL-6 expression, while let-7f-5p mimics significantly reduced it (Figure 3I). These findings indicate that IL-6 expression is regulated by let-7f-5p and IVT mRNA through a ceRNA mechanism, providing insight into the molecular interactions underlying myocarditis associated with COVID-19 mRNA vaccines (Figure 4).