What this is
- This research investigates the impact of human cytomegalovirus (HCMV) infection on -associated genes in () infants.
- Key genes, PER1 and CRY1, were identified as being significantly downregulated in infants infected with HCMV.
- The findings suggest potential new therapeutic targets for managing HCMV infections in this vulnerable population.
Essence
- HCMV infection leads to significant downregulation of genes PER1 and CRY1 in infants, indicating these genes may be critical in understanding HCMV's effects.
Key takeaways
- PER1 and CRY1 mRNA levels were significantly decreased in the PBMCs of HCMV-infected infants compared to controls. This finding underscores the potential role of genes in HCMV pathology.
Caveats
- The study did not assess the protein levels of PER1 and CRY1, limiting the understanding of their functional impact. Additionally, the sample size was small, which may affect the generalizability of the results.
Definitions
- very-low-birth-weight (VLBW): Infants weighing less than 1,500 grams at birth, often facing increased health risks.
- circadian rhythm: The physical, mental, and behavioral changes in a 24-hour cycle, responding primarily to light and darkness.
AI simplified
Introduction
Human cytomegalovirus (HCMV) is a double-stranded DNA virus belonging to the herpes virus subfamily (). People are generally susceptible to HCMV, and the infection rate is between 60% and 93.7% (defined as serum IgG positive) (;). Further, 80–90% of women of reproductive age are reported to be seropositive for cytomegalovirus antibodies (;;), indicating that they have been previously infected or are currently infected with HCMV. In individuals with normal immunity, HCMV infection shows no obvious symptoms, except for those with infectious mononucleosis (). However, serious damage can occur in immunocompromised individuals such as those using immunosuppressants (), organ transplant recipients (), and very-low-birth-weight infants (VLBW) (). Adults with HCMV infection are reported to be more susceptible to autoimmune diseases () and cancer (), whereas VLBW infants are more likely to have hearing loss and stunted growth (). [Manandhar et al., 2019] [Peredo-Harvey, Rahbar & Soderberg-Naucler, 2021] [Zuhair et al., 2019] [Zuhair et al., 2019] [Ssentongo et al., 2021] [Manicklal et al., 2013] [Sridhar et al., 2018] [Gugliesi et al., 2021] [Razonable & Humar, 2019] [Hernandez-Alvarado et al., 2021] [Gugliesi et al., 2021] [Yu et al., 2023] [Weimer et al., 2020]
HCMV, also known as human herpes virus 5, and the virus can establish a latent infection in the host (;) that underpins the lifelong infection (). The transmission routes of HCMV include vertical transmission from mother to child (;;), humoral transmission (, urine, saliva, vaginal secretions (;), and breast milk ()), and iatrogenic transmission (, blood transfusion (;), organ transplantation, and cardiopulmonary bypass). When HCMV enters the body, it can infect many cell types, including epithelial and endothelial cells, fibroblasts, and bone marrow cells (). However, latent infections only exist in the early myeloid lineage, such as CD34hematopoietic stem cells (HSCs), mononuclear progenitor cells, and blood mononuclear cells (). HCMV activates dendritic cells (DC) or macrophages differentiated from HSCs and blood CD14monocytes (;), causing damage to the body through intercellular or cell-free transmission (), if the conditions are conducive to sustained viral replication. Therefore, whether HCMV infection leads to disease is related to the immune status. [Pantry & Medveczky, 2017] [Lepiller et al., 2011] [Pesch & Schleiss, 2022] [Shahar-Nissan et al., 2020] [Hutton & Rowan, 2021] [Prendergast et al., 2019] [Fornara et al., 2022] [Forte et al., 2020] [d’Angelo et al., 2023] [Shigemura et al., 2019] [Atabani et al., 2012] [Maciejewski et al., 1992] [Schwartz & Stern-Ginossar, 2023] [Payen et al., 2024] [Rauwel et al., 2015] [Schultz et al., 2020] e.g. e.g. + +
Recent research () shows that the circadian system can regulate a variety of physiological systems, including the immune system. At the molecular level, most immune cells autonomously express genes that regulate the biological clock, and these genes play a key role in regulating the function of immune cells. [Ding, Chen & Qi, 2024]
Circadian systems are widely distributed among mammals. The molecular mechanism of the circadian rhythm can be described by a feedback loop of transcription-translation oscillations (TTO) comprising a set of clock genes (). The TTO feedback loop consists of three cycles. The first involves the most important core genes, ARNT-like protein 1 (BMAL1) and circadian locomotor output cycle kaput (CLOCK), which form heterodimers that bind to E-box elements in the promoters of the period (PER) and cryptochrome (CRY) genes, thereby inducing expression of the suppressor genes PER and CRY. However, an increase in the expression of inhibitory genes could, in turn, inhibit the expression of BMAL1 and CLOCK. When the expression of BMAL1 and CLOCK genes is downregulated, the effect of the suppressor genes is weakened, allowing the expression cycle to restart in another 24 h. The second cycle includes the REV-ERB and ROR genes, which are activated by a BMAL1-CLOCK heterodimer that binds to the E-box site. Upon ROR activation, REV-ERB inhibits BMAL1 expression. The third cycle is formed by the albumin D-box binding protein (DBP) and the transcription suppressor nuclear factor interleukin-3 (NFIL3, also known as E4BP4), which regulates the transcription of genes containing the D-box sequence, including PER (;). In recent years, circadian control genes (CCGS) have been found to be essential for cell physiology and metabolism (), and the relationship between circadian rhythm genes and numerous diseases, such as cancer, autoimmune diseases, metabolic diseases, neurodegenerative diseases, cardiovascular diseases, and muscle diseases, has been studied (). Futhermore, researchers have found that circadian rhythms are also closely linked with the immune system. First, in the sleep-wake cycle, Th1 cytokines (, IL-2, IFN-γ, and IL-12) persist in the early part of the night, while Th2 cytokines (, IL-4 and IL-10) dominate late sleep (). Disruption of this model leads to disordered cytokine production, leading to immune disorders (). Second, many important immune cells in the immune system exhibit highly autonomous circadian rhythms in terms of number of changes and functional activities. Studies have shown that the loss of BMAL1 not only significantly weakens the circadian migration pattern of neutrophils () but also disrupts the circadian flow pattern of lymphocytes in lymph nodes () and weakens the circadian migration pattern of monocytes and eosinophils (;;). It can also disrupt the circadian rhythm of DC metabolism and function (). [Xiang et al., 2021] [Man, Loudon & Chawla, 2016] [Patke, Young & Axelrod, 2020] [Korencic et al., 2014] [Neves et al., 2022] [Dimitrov et al., 2004] [Zhou et al., 2022] [Palomino-Segura & Hidalgo, 2021] [Oliva-Ramirez et al., 2014] [Holtkamp et al., 2021] [Early et al., 2018] [Gagnidze et al., 2016] [Hopwood et al., 2018] e.g. e.g.
In recent years, the relationship between rhythm genes and viral infections has attracted increasing attention. Hepatitis B virus (HBV) has been studied to influence liver clock genes in order to use liver cells for self-replication (). Reduction of BMAL1 and increased transcription of REV-ERBα and Rev-ERBβ in HBV-infected individuals compared with those in the control group indicate that the transcription of circadian rhythm genes is impaired in HBV infection (). Rev-ERBα agonists can inhibit HBV replication, while BMAL1 promotes viral replication (). A recent study showed that Rev-ERB agonists can reduce the expression of BMAL1 and inhibit HIV LTR activity and replication in cell lines and primary CD4 T cells (). Moreover, studies have shown that hepatitis C virus (HCV) can regulate liver clock genes, and that the circadian rhythm protein PER2 can inhibit HCV viral replication (). [Mazzoccoli et al., 2020] [Zhuang et al., 2021] [Pearson et al., 2021] [Borrmann et al., 2020] [Benegiamo et al., 2013]
The circadian system is so closely related to the immune system, and HCMV can infect a part of immune cells, evade immune surveillance, and play a harmful role when immune function declines. Then, does the expression of circadian rhythm genes change in peripheral blood mononuclear cells (PBMCs) from HCMV infected VLBW infants? It has not been clear. In this study, a published Gene Expression Omnibus (GEO) dataset was first used to analyze key circadian rhythm-related genes in adults with HCMV infection. We then examined transcriptome of VLBW infants to identify rhythmic genes and genes with different expression levels in HCMV infection. Our results provide new insights into the mechanism of HCMV infection and development in VLBW infants and may help identify potential intervention targets.
Materials & Methods
Downloading and preprocessing of data
Microarray results from the transcriptome datasetof adult cytomegalovirus infection and normal control blood samples were obtained from the GEO database (GEO Accession viewer,) and analyzed. Thedataset contains peripheral blood mononuclear cell (PBMCs) samples from 11 symptomatic patients with primary HCMV infection and HCMV-seronegative (= 12) or HCMV-seropositive (= 25) healthy donors. Only the data of 11 symptomatic primary HCMV-infected patients and 12 HCMV-seronegative healthy donors were analyzed in this study. GSE81246 GSE81246 http://www.ncbi.nlm.nih.gov/geo↗ n n
Ethical approval and clinical sample collection
This study was approved by the Ethics Committee of Xuzhou Maternal and Child Health Hospital (Ethics approval number: 2022 No.18). The study included VLBW infants admitted to the neonatal intensive care unit of Xuzhou Maternal and Child Health Hospital between August 2022 and September 2024. They were tested for CMV-DNA-PCR in urine samples collected 1 week after birth from a mixture of more than three random urine samples per day. A urine viral load < 1 × 10copies/ml was defined as negative; otherwise, it was considered positive. If the first test result was negative and the child was breastfed, urine CMV-DNA-PCR was performed every 2 weeks until discharge. If the urine CMV-DNA-PCR results were positive during hospitalization, liver function, platelet count, and automated auditory brainstem response were examined, and the review time and treatment plan were adjusted according to the results. In this study, 12 patients with positive urine CMV-DNA-PCR and serology results were included in the experimental group, and six patients with persistently negative urine CMV-DNA-PCR and serology results were randomly selected as the control group. After diagnosis, blood samples were collected from 9 a.m. to 10 a.m. PBMCs were isolated and stored at −80 °C in RNase-free tubes immediately for follow-up studies. Liver function and routine blood tests were performed to determine Alanine aminotransferase (ALT) and platelet (PLT) levels. Written informed consent was obtained from the parents/guardians of all patients. The patients’ clinical information is presented inand. 3 Tables 1 2
| Characteristic | ||||
|---|---|---|---|---|
| Group | HCMV | Control | HCMV | Control |
| Number | 11 | 12 | 3 | 3 |
| Sex, n (%) | ||||
| Male | – | – | 66.7 (2/3) | 66.7 (2/3) |
| Female | – | – | 33.3 (1/3) | 33.3 (1/3) |
| Abnormal ALT 1 | – | – | 2/3 | 0/3 |
| Abnormal PLT 1 | 2/3 | 0/3 | ||
| Group | Patient | Gestational age | Birth weight (g) | Sex 2 | Delivery mode | Age at diagnosis (d) | ALT (U/L) 2 | PLT (10/L) 9 2 | AABR 2 | CMV viral load(Copies/ml) 2 |
|---|---|---|---|---|---|---|---|---|---|---|
| Control | 1 2 | 29 6/7 | 1,130 | M | Cesarean | – | 14 | 269 | n | n |
| 2 | 28 5/7 | 1,320 | M | Vaginal | – | 8 | 261 | n | n | |
| 3 2 | 30 2/7 | 1,450 | M | Vaginal | – | 8 | 315 | n | n | |
| 4 | 35 6/7 | 960 | M | Cesarean | – | 15 | 214 | n | n | |
| 5 2 | 28 4/7 | 1,130 | F | Cesarean | – | 19 | 150 | n | n | |
| 6 | 29 1/7 | 970 | F | Vaginal | – | 13 | 171 | n | n | |
| HCMV | 1 2 | 28 0/7 | 1,200 | M | Vaginal | 33 | 211 | 129 | n | 2.30 ×106 |
| 2 2 | 26 3/7 | 1,050 | M | Vaginal | 32 | 107 | 183 | Both failed | 4.43 ×106 | |
| 3 2 | 29 1/7 | 920 | F | Cesarean | 42 | 14 | 123 | One failed | 7.17 ×104 | |
| 4 | 35 6/7 | 1,010 | F | Cesarean | 45 | 10 | 107 | n | 6.46 ×105 | |
| 5 | 30 4/7 | 1,230 | M | Cesarean | 8 | 26 | 115 | One failed | 2.58 ×106 | |
| 6 | 29 6/7 | 970 | F | Vaginal | 36 | 16 | 31 | Both failed | 2.83 ×106 | |
| 7 | 30 0/7 | 1,340 | M | Cesarean | 30 | 15 | 147 | One failed | 4.81 ×104 | |
| 8 | 26 3/7 | 790 | F | Vaginal | 56 | 11 | 173 | One failed | 6.87 ×103 | |
| 9 | 26 3/7 | 1,050 | F | Vaginal | 28 | 10 | 244 | n | 5.30 ×105 | |
| 10 | 26 6/7 | 920 | F | Vaginal | 34 | 152 | 25 | One failed | 7.49 ×106 | |
| 11 | 31 6/7 | 1,250 | F | Vaginal | 6 | 10 | 122 | One failed | 4.00 ×106 | |
| 12 | 30 0/7 | 1,240 | F | Cesarean | 16 | 29 | 91 | n | 5.14 ×104 |
RNA sequencing
PBMCs samples of VLBW infants were selected from three control and three HCMV-infected VLBW infants (three biological replications in each group), and the total RNA was extracted and sent to Major Bio (Shanghai, China) for gene and transcriptome sequencing. Finally, these data were submitted to GEO as thedataset with a BioProject ID of. GSE290897 PRJNA1224726
Cluster analysis and differential analysis
The RStudio (R version 3.4;) software package was used to read the downloadeddata in .txt format, and the expression matrix was obtained for analysis. The Limma package was used to analyze differences between the two groups. The data fromwere analyzed online on the MajorBio cloud platform, and the corresponding gene and transcript sequencing data were obtained after analysis. The Limma package was used to analyze differences between the two groups of patients. With< 0.05 and Log—FC (fold change)—> 1.5 as the criteria for significant difference in expression, the corresponding volcano maps were obtained using the Weishengxin platform () (). GSE81246 GSE290897 [R Core Team, 2017] [Tang et al., 2023] P 2 http://www.bioinformatics.com.cn/↗
Functional enrichment analysis
We then used Metascape () () for functional enrichment and clustering analysis of the expression levels of differential genes or transcripts, including Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) analyses, and the corresponding volcano maps were obtained using the Weishengxin platform (). GO and KEGG pathways were significantly enriched with< 0.05 (-values were calculated using the Benjamini–Hochberg procedure to account for multiple testing). The bar and bubble maps were generated using Weishengxin. GO (Gene Ontology Resource,) indicates the biological process (BP), molecular function (MF) and cellular component (CC) (), along with other aspects that indicate the function of genes and gene products. A heat map was created using BioLadder (). https://metascape.org/gp/index.html#/main/step1↗ http://www.bioinformatics.com.cn/↗ https://geneontology.org/↗ https://www.bioladder.cn/web/#/pro/cloud↗ [Zhou et al., 2019] [Carbon et al., 2009] Padj P
Analysis of key genes using reverse transcription polymerase chain reaction and quantitative polymerase chain reaction
RNA extraction and reverse transcription were performed as described previously for PBMCs (). Briefly, total RNA was extracted using the TRIzol method and cDNA was reverse-transcribed using the All-In-One 5X RT Master Mix (Abm; G592, Jiangsu, China). The reverse transcription polymerase chain reaction (RT-PCR) system included All-In-One 5X RT MasterMix 4 µl, RNA 2 µg, added to the final volume of 20 µl with enzyme-free water, mixed evenly on ice, and reverse transcription was carried out under the following conditions: 37 °C for 15 min, 60 °C for 10 min, 95 °C for 3 min, and cDNA could be obtained. Quantitative polymerase chain reaction (qPCR) was performed using a LightCycler 480 SYBR Green I Master Mix (04887352001; Roche, Mannheim, Germany). The reaction volume was 10 µl, which included SYBR Green PCR master Mix 5 µl, ddHO 3 µl, cDNA 1 µl, and the forward and reverse primers (0.5 µl each). The amplification procedure was as follows: 5 min at 95 °C, followed by 45 cycles of 15 s at 95 °C, 20 s at 60 °C, and 20 s at 72 °C. Real-time data acquisition and quantitative analysis were performed using the LightCyler480 software. The expression level of the target gene was normalized against the expression level of β-actin using the 2method. The qPCR primers used in this study are listed in. [Yang et al., 2023] Table 3 2 −ΔΔCt
| Name | DNA sequence |
|---|---|
| β-actin | F: GGCCAACCGCGAGAAGATGAC |
| R: GGATAGCACAGCCTGGATAGCAAC | |
| PER1 | F: AACTCATGACAGCACTTCGAGAG |
| R: CACTGCTGGTAGTATTCCTGGTT | |
| CRY1 | F:GTCAGGAGGGTTGGATTCATCAT |
| R:CCACATCCAACTTCCAGCATTTA |
Statistical analysis
The data were analyzed using SPSS 19.0 and expressed as the mean ± standard deviation (SD). The homogeneity of variance was clarified using the Levene test. For normally distributed data, Student’s-test was used to compare between continuous variables, and the Mann–Whitney U test was used for skewed data. Data were analyzed by investigators who were blinded to the experiment. RT-qPCR experiments were independently repeated three times (technical replicates).< 0.05 was considered statistically significant. t P
Results
Patient characteristics
presents the details of 23 patient samples from thedataset, including 11 primary cytomegalovirus infection samples and 12 HCMV serologically negative samples. Specific clinical features and laboratory data of 20 patients with primary CMV infection were described in the associated study, but only 11 samples were included in the dataset, and specific patient demographic data could not be defined. The samples submitted toincluded one sample with abnormal ALT, one sample with abnormal PLT, one sample with abnormal ALT and PLT, along with three control samples. GSE81246 GSE290897 Table 1
Among very or extremely low-birth-weight infants, CMV infection was more common in female (66.67%) and vaginally delivered infants (58.33%). In a majority of patients (75%), the first positivity time was longer than 21 d after birth. The number of patients with decreased PLT (75%) was higher than that of patients with abnormal ALT levels (25%), and 66.67% had hearing impairment. Further details are presented in. Table 2
Differentially expressed genes or transcripts in the two datasets
Through data preprocessing, 25,137 gene expression values were obtained from. There were 1,145 upregulated and 1,387 downregulated genes. The statistical power of our experimental design, calculated in RNASeqPower was 0.8674399. In total, 63,241 transcripts were obtained from, including 1,040 upregulated transcripts and 1,890 downregulated transcripts (). GSE81246 GSE290897 Fig. 1
Identification of differentially expressed genes in peripheral blood mononuclear cells of the two groups. (A–B) Volcano map of differentially expressed genes or transcripts. Volcano maps show that each group of genes or transcripts is based on two factors: fold change (FC) in expression and-value (-test). Significantly down-regulated genes or transcripts are marked in blue. Significantly up-regulated genes or transcripts are marked in red; genes or transcripts with no significant differences are shown in gray. P T
KEGG pathways analysis
KEGG pathway enrichment analysis of differentially expressed genes or transcripts in the control group was performed using Fisher’s exact test. We then compared the KEGG annotation results for each differentially expressed gene and transcript.shows 10 pathway categories enriched with differentially expressed genes or transcripts in() and() (< 0.05). Fisher’s exact test was used to determine the significance of the differences. Since we wanted to explore whether the expression of rhythm genes was changed in HCMV-infected immune cells, we focused on the categories of pathways associated with rhythm genes. We found that in thedataset (), the difference in the Cell cycle pathway was significant, and Circadian rhythm pathway and Circadian entrainment pathway were also successfully enriched and significant. However, in thedataset (), there were no significant differences in circadian rhythmic-related pathways, but the cell cycle pathway was successfully enriched and showed significant differences. GSE81246 GSE290897 GSE81246 GSE290897 Figure 2 Fig. 2A Fig. 2B Fig. 2A Fig. 2B Padj
In both datasets, commonly enriched KEGG pathways include cell cycle, Pathways in cancer, Lipid and atherosclerosis, Human cytomegalovirus infection, Ras signaling pathway.
Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis. Bar graphs show the results of KEGG pathway annotation analysis for differentially expressed genes or transcripts , and the line graphs represent the count of genes enriched in each pathway. (A) KEGG enrichment analysis of thedataset. (B) KEGG enrichment analysis of thedataset. The vertical axis shows the enrichment of the two groups for KEGG pathways, and the horizontal axis represents the −log10 (P) value. The red line annotation section represents the same enrichment results as the KEGG pathway annotation between the two datasets. An asterisk (*) indicates the results related to circadian rhythms that we focus on. GSE81246 GSE290897
GO functional analysis
Gene ontology (GO) is divided into three main categories: biological processes (BP), molecular functions (MF), and cellular components (CC). Each differentially expressed gene or transcript was compared with the annotated results using the GO function. The enrichment of GO entries was visualized using bubble and bar charts for the three main GO categories, as shown in–(< 0.05). Figs. 3 6 Padj
In thedataset, we focus on the enriched GO entries related to circadian rhythms and cell cycles.andshow 14 related enriched processes in BP, including regulation of cell cycle process, entrainment of circadian clock, response to light stimulus, entrainment of circadian clock by photoperiod, circadian regulation of gene expression, regulation of cellular response to stress, photoperiodism, circadian rhythm, regulation of circadian rhythm, rhythmic process, and regulation of translation.andshow 10 terms with the largest variation in CC, including chromosomal region, side of membrane, receptor complex, spindle, and centrosome.andshow 10 enriched functions in MF, Including transcription factor binding, DNA-binding transcription factor binding, DNA-binding transcription repressor activity, RNA polymerase II-specific, histone deacetylase binding, chromatin DNA binding, transcription coregulator binding, RNA polymerase II-specific DNA-binding transcription factor binding, transcription corepressor activity, and nuclear receptor binding. GSE81246 Figures 3 4 Figures 3 4 Figures 3 4
In thedataset, we also want to focus on the enriched GO entries related to circadian rhythms and cell cycles. However, there were almost no items directly enriched in the category related to circadian rhythms, and indirectly enriched items such as the cell cycle, translation and transcription, and responses to stress or stimulus can be significantly enriched.andshow 14 related enriched processes in BP, including regulation of gene expression, cellular response to stress, regulation of RNA metabolic process, regulation of cell cycle, regulation of cellular response to stress, regulation of RNA biosynthetic process, regulation of DNA-templated transcription, regulation of translation, and regulation of cell cycle process.andshow 10 enriched terms with the largest change in CC, including lytic vacuole, lysosome, cytoplasmic vesicle lumen, vesicle lumen, and primary lysosome.andshow 10 enriched functions in MF, including RNA binding, RNA polymerase II-specific DNA-binding transcription factor binding, nucleic acid binding, DNA-binding transcription factor binding, transcription factor binding, nuclear receptor binding, mRNA binding, and transcription coregulator activity. GSE290897 Figures 5 6 Figures 5 6 Figures 5 6
In both datasets, the commonly enriched entries in BP were regulation of cellular response to stress, regulation of translation, and regulation of cell cycle process. Commonly enriched entries in CC included lytic vacuole. Commonly enriched entries in MF included RNA polymerase II-specific DNA-binding transcription factor binding, DNA-binding transcription factor binding, transcription factor binding, nuclear receptor binding, and transcription coregulator activity.
Gene ontology (GO) annotation statistics of differentially expressed genes in thedataset (bar graph). GSE81246 The horizontal axis shows the functional enrichment of GO for BP, CC, and MF. The vertical axis represents the −log10 (P) value.
Gene Ontology (GO) annotation statistics of differentially expressed genes in thedataset (bubble diagram). GSE81246 Bubble diagram shows the functional enrichment of GO for BP, CC, MF. The red line annotation section represents the same enrichment results as those of the GO annotation for thedataset. An asterisk (*) indicates the results related to circadian rhythms that we focus on. GSE290897
Gene Ontology (GO) annotation statistics of differentially expressed transcripts in thedataset (bar graph). GSE290897 The horizontal axis shows the functional enrichment of GO for BP, CC, and MF. The vertical axis represents the −log10 (P) value.
Gene Ontology (GO) annotation statistics of differentially expressed transcripts in thedataset (bubble diagram). GSE290897 Bubble diagram shows the functional enrichment of GO for BP, CC, MF. The red line annotation section represents the same enrichment results as those of the GO annotation for thedataset. An asterisk (*) indicates the results related to circadian rhythms that we focus on. GSE290897
The same differential rhythm genes were selected and their expression was verified by RT-qPCR
We further analyzed the results directly and indirectly related to circadian rhythms and cell cycles in the KEGG enrichment pathway and GO enrichment entries to identify rhythm genes with the same changing trends in the two datasets. We found that PER1, PER2, PER3, and CRY1 were downregulated in the infection compared to the control group in(), while PER1 and CRY1 were downregulated in the infection compared to the control group in(). Furthermore, RT-qPCR was used to explore the mRNA expression changes in PER1 and CRY1 in the PBMCs of the HCMV-infected (= 12) and control groups (= 6) in the VLBW infants (). The results showed that the mRNA of PER1 was significantly downregulated in the HCMV-infected group compared with the control group (= 0.000,= − 3.373,< 0.0001). Meanwhile, CRY1 mRNA levels were significantly downregulated in the HCMV-infected group (= 0.000,= − 3.372,< 0.0001). The study showed that the mRNA levels of these two circadian rhythm genes were decreased in the HCMV-infected infants than in the control group. GSE81246 GSE290897 Fig. 7A Fig. 7B Fig. 7C n n U Z P U Z P
Target gene screening and verification. (A–B) Heat maps of theandexpression matrices. (C) PER1 and CRY1 mRNA expression in peripheral blood mononuclear cells from VLBW infants was detected using RT-qPCR; PER1 and CRY1 mRNA expression was significantly lower in the HCMV infection group (= 12) than in the control group (= 6). ****< 0.0001. GSE81246 GSE290897 n n P
Discussion
Due to the close connection between the immune system and the circadian system, and the fact that immunosuppressed people are more susceptible to HCMV attack and accompanied by symptoms, our study hypothesized that the expression of rhythm genes in PBMCs from HCMV infected VLBW infants would be changed. To verify this hypothesis, we first analyzed the differential genes in thedataset and enriched the pathways related to circadian rhythm pathway. The enrichment results of KEGG and GO showed that both the circadian rhythm pathway and the cell cycle pathway were significantly enriched. Since circadian rhythm () can regulate cell cycle, DNA damage repair, metabolism,, we also included these entries in the analysis. Secondly, we provided thedataset to explore whether there were also differential alterations in rhythm genes in PBMCs of HCMV-infected VLBWs. The results showed that although the circadian rhythm pathways were not significantly enriched, the cell cycle, metabolic and other pathway categories were significantly enriched. Furthermore, through the enrichment and analysis of entries such as rhythm regulation, cell cycle regulation, cellular responses to stimuli or stress, and transcriptional regulation, the results showed that in, PER1, PER2, PER3, and CRY1 were significantly downregulated in the infection compared to the control group, while in, only PER1 and CRY1 were significantly downregulated in the infection compared to the control group. Finally, by increasing sample size, it was confirmed that the mRNA expressions of PER1 and CRY1 in the infection group (= 12) were indeed significantly downregulated compared with those in the control group (= 6) in VLBWs. This implies that PER1 and CRY1 are associated with HCMV infection and that PER1 and CRY1 could be potential intervention targets. This is consistent with the research of. Inhibiting the circadian rhythm gene Bmal1 could enhance herpesvirus infection, and herpesviruses could also target circadian rhythm components in different ways. However,found that for recipients who received organ transplants at different times of a day, there was no significant change in cytomegaloviremia in their bodies. But the study also indicated that patients in need of organ transplants typically use immunosuppressants including glucocorticoids, which can affect the circadian rhythm of the immune system. GSE81246 GSE290897 GSE81246 GSE290897 [Fortin et al., 2025] [Edgar et al. (2016)] [Rafferty et al. (2022)] etc. n n
The results of this study further reveal the relationship among HCMV infection and cell cycle, cancer, lipids and atherosclerosis pathways. This finding is consistent with those of several previous studies (;;;;). Studies have shown that to replicate its long double-stranded DNA genome, HCMV induces changes in cell cycle regulation. The hallmark of HCMV cell cycle control is the establishment of abnormal cell cycle arrest at the G1/S transition (). Meanwhile, several studies have demonstrated a relationship between HCMV and cancer.showed that breast cancer cells are susceptible to HCMV, and that HCMV replication can be detected after infection, whileshowed that high-risk HCMV strains may induce a carcinogenic environment that promotes breast cancer development. These studies suggest that HMCV infection is closely associated with breast cancer development. Other studies () have shown that clinical strains of HCMV isolated from glioblastoma multiforme, transformed into CMV-elicited glioblastoma cells, and then transplanted into the brains of mice can form glioblastomas. This indicates that some highly pathogenic strains of HCMV are associated with glioblastoma occurrence and development. Further, other studies suggest that HCMV may promote atherosclerosis progression through the immediate-early 2 gene (IE2) (). [Bogdanow, Phan & Wiebusch, 2021] [Branch et al., 2021] [Haidar Ahmad et al., 2021] [Guyon et al., 2024] [Ma et al., 2023] [Bogdanow, Phan & Wiebusch, 2021] [Branch et al. (2021)] [Haidar Ahmad et al. (2021)] [Guyon et al., 2024] [Ma et al., 2023]
Through the two datasets of commonly enriched GO entries, we found that in biological processes, in addition to the regulation of cell cycle processes, the regulation of cellular response to stress and the regulation of translation were also significantly enriched.indicate that cells infected with HCMV induce replication stress, leading to replication fork asymmetry and the formation of 53BP1 foci, ultimately triggering DNA damage responses and chromosomal instability.showed that normally capped mRNA translation in cells is eif4E-dependent, whereas capped mRNA translation in HCMV-infected cells is eIF3d dependent, which facilitates HCMV replication and induces virus-induced chronic endoplasmic reticulum stress. In cellular component, the GO entry lytic vacuole, which is co-enriched by the two datasets, has been extensively studied mostly in plants and limited to the enriched GO entries screened by RNA sequencing in human studies. For instance,’s () research demonstrated that in the RNA sequencing results of PBMCs from patients with sepsis and healthy controls, the lysosome-related items enriched by KEGG and GO included lytic vacuole. The commonly enriched item in the molecular function of the two datasets is mainly transcription factor binding, which is easy to understand, because HCMV can regulate transcription factors after infecting cells to facilitate immune evasion of itself or cancer cells (). [Merchut-Maya et al. (2022)] [Thompson et al. (2022)] [Chen et al.] 2023 [Feng et al., 2025]
The two genes that we screened, PER1 and CRY1 are both rhythm genes that have been widely studied in adult sleep disorders, mood disorders, inflammatory bowel diseases, tumors, and other fields in recent years; however, few studies have focused on neonates. PER1 overexpression has been reported to protect the respiratory tract by reducing the response of calcium ions to histamine in respiratory tract cells under a high-oxygen environment (). Other studies have shown that exposure to 3-methyl-4-nitrophenol (PNMC) affects follicular development and ovarian function in neonatal mice by interfering with the expression of clock genes including CRY1 and PER1 (). These results suggest that rhythm genes also play an important role in the neonatal period. PER1 and CRY1 are components of the core clock protein and are key components of the core negative feedback loop that constitutes the circadian rhythm pathway. Therefore, we identified PER1 and CRY1 as the key rhythm genes (). [Bartman et al., 2021] [Fan et al., 2022] [Crosby & Partch, 2020]
In our study, gene enrichment results were used for, whereas transcript enrichment results were used forbecause no significant differences related to rhythm were found in the gene enrichment results of thedataset. This may be attributed to the transcriptome regulation at different functional stages and times of development and to the changes in circadian rhythm dynamics (;). GSE81246 GSE290897 GSE290897 [Fan et al., 2022] [Kaune et al., 2022]
In this study, for the first time, we compared the expression changes of different genes in neonatal and adult HCMV infections and found that PER1 and CRY1 were significantly downregulated in PBMCs of HCMV-infected patients compared with the control group. However, this study has some limitations. First, we only made a horizontal comparison of the changes in the mRNA expression levels of PER1 and CRY1 in PBMCs between HCMV-positive and HCMV-negative VLBWs, but we did not collect blood samples from HCMV-positive VLBWs before they were diagnosed. In addition, PBMCs mainly include lymphocytes and monocytes. Does HCMV infection of monocytes affect the mRNA of PER1 and CRY1 in lymphocytes? Therefore, we are not clear whether the mRNA changes of PER1 and CRY1 are the cause or the effect of HCMV infection, or even an unrelated correlation. Second, since all the collected samples were tested by RNA-seq or RT-qPCR, the corresponding protein tests could not be conducted, and the consistency between the changes in protein levels and mRNA changes could not be determined. Third, whether overexpression of PER1 or CRY1 would affect CMV replication remained unclear. Further more. Our center treats approximately 100 VLBWs each year. However, the positive rate of HCMV during hospitalization is relatively low. Therefore, Among the 12 cases with HCMV-positive results in urine and serum, only one case was asymptomatic. So no comparison was set between the seropositive VLBWs with and without symptoms. In the future, as the sample size expands or multiple centers are combined, a comparison between these two groups of cases may be conducted. Therefore, further investigation is needed to address these limitations.
Conclusion
We first conducted enrichment analysis on the transcriptomes of adult HCMV infection and control groups in thedataset, and then performed transcriptomic enrichment analysis on HCMV infection and control groups in VLBW infants. We screened and verified circadian genes related to HCMV infection. Our results suggest that PER1 and CRY1 are the circadian rhythm-associated genes as differentially expressed genes in PBMCs from HCMV infected VLBW infants, and that these genes may be associated with the pathological process of HCMV infection. Overall, these findings provide new insights into the study of potential effective therapeutic targets for HCMV infection in VLBW infants. GSE81246