What this is
- Docosahexaenoic acid (DHA) enhances neuronal resilience against -reoxygenation stress.
- The study uses NGFDPC12 cells to explore how DHA affects and oxidative stress.
- Findings indicate that DHA restores key -related gene expressions suppressed by .
Essence
- DHA improves cell survival in neuronal-like cells under hypoxic conditions by restoring and limiting oxidative stress. The study identifies DHA's role in activating pathways as a neuroprotective mechanism.
Key takeaways
- DHA pretreatment significantly reduces -induced apoptosis in NGFDPC12 cells. Annexin V-positive cells decreased from 3.2±0.3-fold () to 1.2±0.2-fold with DHA treatment.
- DHA enhances the expression of -related genes Atg5, Atg7, and Atg12, increasing their levels 3.0±0.3-fold, 2.7±0.4-fold, and 3.0±0.5-fold, respectively, compared to normoxia.
- DHA increases Beclin-1 phosphorylation 4.6±0.4-fold in normoxia and 4.2±0.5-fold in , indicating activation of signaling even under stress conditions.
Caveats
- The study was conducted in differentiated PC12 cells, which may not fully replicate human neuronal responses to .
- Further research is needed to confirm these findings in primary neuronal cultures and in vivo models to enhance physiological relevance.
Definitions
- Autophagy: A cellular process that degrades and recycles damaged organelles and proteins, essential for cell survival and homeostasis.
- Hypoxia: A condition in which there is a deficiency of oxygen in the tissues, often leading to cellular injury or death.
AI simplified
Introduction
The central nervous system (CNS) depends primarily on oxidative phosphorylation for energy production. During ischemia or hypoxia, this dependency renders neurons vulnerable to energy failure, leading to acidosis, glutamate excitotoxicity, and osmotic swelling (Dirnagl et al. 1999). Cells in the infarct core undergo necrosis, with the ischemic cascade extending to the penumbra (Radak et al. 2017). Subsequent processes involve oxidative stress, inflammation, and apoptosis (Kanekar et al. 2012). As post-mitotic cells, neurons cannot dilute toxins via division and rely heavily on autophagy for clearing damaged organelles and sustaining homeostasis (Maday 2016). Autophagy is crucial for neuronal survival and synaptic integrity, with neurons exhibiting greater dependence on basal autophagic flux than most cell types (Hara et al. 2006; Komatsu et al. 2006; Sidibe et al. 2022).
Docosahexaenoic acid (DHA; 22:6 n-3) is the predominant omega-3 polyunsaturated fatty acid in the CNS, comprising ~ 40% of polyunsaturated acyl chains in gray matter phospholipids (Lauritzen et al. 2000; Yehuda et al. 2002). Its multiple double bonds confer membrane fluidity, influencing biophysical properties and functional outcomes. DHA serves as precursor to specialized pro-resolving mediators (SPMs), including neuroprotectin D1, which mitigate inflammation and promote repair (Bazan 2005; Serhan and Petasis 2011). In hypoxic-ischemic models, DHA reduces infarct volume, neuronal loss, and oxidative stress while preserving mitochondrial function (Mayurasakorn et al. 2011). Notably, DHA promotes mitophagy—a selective autophagic process—to clear damaged mitochondria, alleviating ROS and supporting survival in PC12 cells under oxygen–glucose deprivation (Sun et al. 2022).
Our laboratory has adopted nerve growth factor differentiated rat pheochromocytoma 12 cells (NGFDPC12 cells) as an in vitro model to study neuronal injury. As a post-mitotic neuronal phenotype with neurites and hypoxia responsiveness, NGFDPC12 cells provide a validated model for studying ischemic injury and autophagic pathways (Greene and Tischler 1976; Medina-Pulido et al. 2013; Woronowicz et al. 2007). Our prior work showed DHA protects against lipotoxicity in NGFDPC12 cells and primary Schwann cells by maintaining lysosomal function, inhibiting mitochondrial permeabilization, and blocking apoptosis (Almaguel et al. 2010; Descorbeth et al. 2018; Montero et al. 2020). DHA also suppresses necroptosis and enhances autophagy, evidenced by LC3-II accumulation (Montero et al. 2020). Given hypoxia-reoxygenation induces ATP depletion, ROS, and calcium dysregulation, we posited DHA confers protection via autophagic activation. Here, we demonstrate DHA pretreatment boosts autophagic pathway in NGFDPC12 cells during 0.5% O₂ hypoxia followed by reoxygenation, with phosphorylated Beclin-1 and LC3-II as key markers. Elucidating this mechanism may inform omega-3-based therapies to attenuate ischemic neuronal damage.
Materials and Methods
Reagents and Materials
Ham’s F-12 medium with Kaighn’s modification (F-12 K; Mediatech, Inc., Manassas, VA) was used for all cell cultures. Horse serum and fetal bovine serum (Neuromics, Edina, MN) were supplemented as indicated. Human recombinant β-nerve growth factor (NGF; Thermo Fisher Scientific, Waltham, MA) was used for differentiation. Fatty acid-free bovine serum albumin (BSA; Cat# 126575-10GM, MilliporeSigma, Billerica, MA), docosahexaenoic acid (DHA; Cat# 90310, Cayman Chemical, Ann Arbor, MI), and rapamycin (Cat# 9904 S, Cell Signaling Technology, Danvers, MA) were used as described below. Halt protease & phosphatase inhibitor cocktail (Cat# 78441, Thermo Fisher Scientific) were included in all extraction buffers.
Cell Culture and Differentiation
PC12 cells (rat pheochromocytoma; RRID: CVCL_0481, ATCC Cat# CRL-1721) were cultured on poly-L-lysine–coated six-well plates in F-12 K medium containing 15% horse serum, 2.5% fetal bovine serum (FBS), and 1% penicillin/streptomycin. Differentiation was initiated by switching to F-12 K medium supplemented with 50 ng/mL NGF, 1% FBS, and antibiotics (hereafter “1% FBS–NGF medium”). Medium was refreshed every 2–3 days, and cells were maintained for 7–10 days until extensive neurite outgrowth formed interconnected networks. Only fully differentiated cultures were used for experiments.
Hypoxia–Reoxygenation Exposure
For hypoxia, NGFDPC12 cells in 1% FBS–NGF medium were placed in a Galaxy 48 R CO₂ incubator equipped with an O₂ controller (Eppendorf, Hauppauge, NY) maintained at 37 °C, 5% CO₂, and 0.5% O₂ (balanced with N₂). Normoxic controls were cultured at 37 °C, 5% CO₂, and ambient O₂ (~ 19.9%). Cells were subjected to hypoxia for 12–48 h followed by 12 h reoxygenation under normoxic conditions. Morphological changes were monitored by phase-contrast microscopy using an Olympus microscope with a SPOT-Insight CMOS camera.
Fatty Acid Preparation and Treatment
DHA stocks (50 mM in ethanol) were freshly complexed with 150 µM fatty acid-free BSA in 1% FBS–NGF medium before use to make final fatty acid concentration of 50 µM (Clementi et al. 2019; Maralbashi et al. 2024; Montero et al. 2020; Zhang et al. 2018). BSA serves as fatty acid vehicle to ensure the concentration of unbound free fatty acids in the media is at constant level during incubation and the concentration of 150 µM, which is approximately 1% w/v, is within the range commonly used to prepare fatty acids solution for cell culture experiments (Ge et al. 2018; Ng and Say 2018; Ortiz-Rodriguez et al. 2019; Ricchi et al. 2009). For sets of experiments, NGF-differentiated PC12 cells were pretreated for 48 h with 50 µM DHA and then switched to 1% FBS–NGF medium before hypoxic exposure. During the fatty acid pretreatment, the control cells were incubated with 1% FBS–NGF medium containing 150 µM BSA and 0.1% ethanol.
Quantitative Real-Time PCR (qRT-PCR)
Total RNA was extracted using TRI-Reagent (Molecular Research Center, Cincinnati, OH) and quantified spectrophotometrically (A260/A280 ≥ 1.9). cDNA was synthesized using the iScrip cDNA Synthesis kit (Bio-Rad Laboratories, Hercules, CA). qRT-PCR was performed using SYBR Green Master Mix (Bio-Rad) on a CFX96 Real-Time PCR Detection System (Bio-Rad). Primer specificity was verified by melt-curve analysis. Relative gene expression was calculated by the 2^-ΔΔCT method using β-actin as the reference gene and normoxic controls as calibrators. Primer sequences were as follows:
| Gene | Forward (5′→3′) | Reverse (5′→3′) |
|---|---|---|
| HIF-1α | TCCATGTGACCATGAGGAAA | CTTCCACGTTGCTGACTTGA |
| BNIP3 | CCAGAAAATGTTCCCCCCAAG | TTGTCAGACGCCTTCCAATGTAG |
| FABP5 | TTACCCTCGACGGCAACAA | CCATCAGCTGTGGTTTCATCA |
| β-actin | GGGAAATCGTGCGTGACATT | GCGGCAGTGGCCATCTC |
| ATG5 | TGTCTCTGCTGTCCTGTTGG | GCAGCGAACTTCCCTTACTG |
| ATG7 | CCCAAAGACATCAAGGGCTA | CCTGACTTTATGGCTTCCCA |
| ATG12 | CGTCTTCGGTTGCAGTTTC | CCAGTTTACCATCACTGCCA |
Reactive Oxygen Species (ROS) Assay
Intracellular ROS were quantified by flow cytometry using 10 µM 2′,7′-dichlorodihydrofluorescein diacetate (H₂DCFDA; Invitrogen). After treatments, cells were incubated with dye for 25 min at 37 °C, detached with HyQtase (GE Healthcare), washed twice, and analyzed on a BD FACSCalibur flow cytometer (excitation = 488 nm; emission = 530 nm). Cells treated with 10 µM DL-buthionine-[S, R]-sulfoximine (BSO) for 24 h served as positive controls.
Apoptosis Detection
Apoptosis was quantified using Annexin V–FITC staining. Following treatment, cells were detached with HyQtase, washed in binding buffer, and incubated with Annexin V–FITC for 20 min at room temperature in the dark. At least 10,000 events per sample were analyzed by flow cytometry, as previously described (Padilla et al. 2011).
Cell Viability Assay
Cell viability was determined using the WST-1 assay (Roche Diagnostics). After treatments, medium was replaced with 2 mL of F-12 K containing 200 µL of WST-1 reagent per well. After 2 h incubation at 37 °C, absorbance was measured at 450 nm using a SpectraMax i3X spectrophotometer (Molecular Devices, Sunnyvale, CA). Blank readings (medium + reagent only) were subtracted, and data were expressed as a percentage of the control group.
Immunoblotting
Total protein was extracted in Laemmli sample buffer (0.1 M Tris-HCl, pH 6.8, 4% SDS, 10% glycerol, protease & phosphatase inhibitors) and quantified by DC Protein Assay (Bio-Rad). Equal amounts of protein (15–40 µg) were separated on NuPAGE Bis-Tris gels (Invitrogen) and transferred to nitrocellulose membranes. Membranes were blocked with Intercept blocking buffer (Li-Cor Biotechnology, Lincoln, NE) and incubated overnight at 4 °C with primary antibodies against LC3A/B (Cat# 4108 S, CST) and phospho-Ser93-Beclin-1 (Cat# 14717 S, CST) and total Beclin-1 (Cat# 3495 S, CST). IRDye-labeled secondary antibodies were applied for detection on an Odyssey imaging system (Li-Cor Biotechnology). Band intensities were quantified using Image Studio 5.5 and normalized to β-actin.
Statistical Analysis
All data are presented as mean ± SEM from at least three independent experiments and technical triplicate measurements were performed in WST-1 and real-time PCR assay. Statistical analyses were carried out in GraphPad Prism 9.4.1. Comparisons between two groups were performed using unpaired two-tailed Student’s t-tests. Multiple group comparisons employed one-way or two-way ANOVA followed by Tukey’s post-hoc test. Normality and variance homogeneity were verified prior to analysis. Statistical significance was accepted at p < 0.05.
Results
Hypoxia Induces Oxidative and Apoptotic Stress Responses in NGFDPC12 Cells
Exposure of NGFDPC12 cells to 0.5% O₂ for up to 48 h significantly increased HIF-1α mRNA in a time-dependent manner (2.5 ± 0.3-fold at 12 h; 6.0 ± 0.7-fold at 48 h; p < 0.01) (Fig. 1a). Expression of the downstream target BNIP3 similarly rose 2.3–3.4-fold (Fig. 1b). Hypoxia also elevated apoptosis and oxidative stress: Annexin V–positive cells increased 2.6-fold (Fig. 1c), and intracellular ROS rose 2.7-fold relative to normoxia (Fig. 1d). The antioxidant MCI-186 (50–100 µM) attenuated ROS levels to ~ 1.5-fold, confirming oxidative involvement. FABP5, a stress-response gene, was up-regulated during hypoxia and suppressed by MCI-186 (Fig. 1e and f). Together, these results establish that exposure 0.5% O₂ for more than 24 h serves as a reliable in vitro model of neuronal hypoxic stress.
Hypoxia induces stress-related gene expression, ROS accumulation, and apoptosis in NGFDPC12 cellsCells were exposed to 0.5% O₂ for 12–48 h. ()and ()mRNA levels were quantified by qRT-PCR. () Annexin V–positive cells were measured by flow cytometry after 24 h of hypoxia. () Intracellular ROS after 24 h of hypoxia were analyzed using the DCF assay with or without antioxidant MCI-186 (50–100 µM). ()expression after 24–48 h of hypoxia was measured by qRT-PCR. ()expression after 48 h of hypoxia was measured by qRT-PCR in the presence or absence of antioxidant MCI-186. Data represent mean ± SEM (≥ 3). For panels A and B, each data point represents the mean of three technical replicate measurements obtained in a single independent experiment. *< 0.05; **< 0.01; ****< 0.0001 . HIF-1α BNIP3 FABP5 FABP5 n p p p a b c d e f
DHA and Rapamycin Protect NGFDPC12 Cells from Hypoxic Injury
Pretreatment with 50 µM DHA or co-treatment with rapamycin significantly reduced hypoxia-induced apoptosis. Annexin V-positive cells decreased from 3.2 ± 0.3-fold (hypoxia) to 1.2 ± 0.2-fold with either treatment (p < 0.001) (Fig. 2a). WST-1 assays confirmed improved viability after 48 h hypoxia: 38.6 ± 4.2% (hypoxia) vs. 79.5 ± 5.0% (DHA) and 92 ± 4% (rapamycin) (p < 0.001) (Fig. 2b). Morphologically, DHA- and rapamycin-treated cells retained neurite structure and confluency compared with hypoxic controls (Fig. 2c), indicating preserved cellular integrity.
DHA and rapamycin protect NGFDPC12 cells from hypoxic injury. Cells were pretreated with DHA (50 µM) for 48 h or co-treated with rapamycin (100 nM) during hypoxia. () Apoptosis was assessed using the Annexin V assay after 24 h of hypoxia. () Cell viability was determined by the WST-1 assay after 48 h of hypoxia. () Representative phase-contrast images show cell morphology at 200x total magnification. Data = mean ± SEM (n ≥ 3); *< 0.05; **< 0.01; ***< 0.001; ****< 0.0001. a b c p p p p
DHA Restores Expression of Autophagy-Related Genes Suppressed by Hypoxia
The Atg7, Atg5 and Atg12 mRNA levels exhibit a downward trend after hypoxia treatment. (Fig. 3a). Atg7 transcripts were significantly reduced after 18 h and Atg5 transcripts were significantly reduced at 48 h. DHA pretreatment counteracted this suppression, increasing expression of Atg7 (3.0 ± 0.3-fold), Atg5 (2.7 ± 0.4-fold), and Atg12 (3.0 ± 0.5-fold) relative to normoxia (p < 0.001) (Fig. 3b). Thus, DHA enhances the autophagy machinery impaired by hypoxia.
DHA restores autophagy-related gene expression suppressed by hypoxia. () Cells were exposed to 0.5% O₂ for 12–48 h. () Cells were pretreated with DHA (50 µM) or vehicle (BSA) for 48 h and then subjected to 48 h hypoxia.,, andmRNA levels were measured by qRT-PCR. Data = fold-change relative to normoxia (mean ± SEM, n ≥ 3). *< 0.05; **< 0.01; ***< 0.001; ****< 0.0001. a b Atg7 Atg5 Atg12 p p p p
DHA Enhances Beclin-1 Phosphorylation and LC3 Lipidation Under Hypoxia
Western blot analyses revealed that hypoxia reduced phospho-Beclin-1 (Ser93) to 0.5 ± 0.1-fold of control (p < 0.05), while DHA increased it 4.6 ± 0.4-fold in normoxia and 4.2 ± 0.5-fold in hypoxia (p < 0.01) (Fig. 4a). Total Beclin-1 levels remained unchanged across experimental conditions (Supplemental Fig. 1), reinforcing the proposed mechanistic framework. LC3-II levels also fell under hypoxia (0.58 ± 0.08-fold) but rose to ~ 2.0 ± 0.3-fold with DHA (Fig. 4b). These results demonstrate that DHA activates Beclin-1–dependent autophagy signaling and autophagosome formation even under hypoxic conditions.
DHA enhances Beclin-1 phosphorylation and LC3 lipidation under hypoxia. Cells were pretreated with DHA (50 µM) or vehicle (BSA) and exposed to 0.5% O₂ for 24 h. () Beclin-1 (Ser93) phosphorylation and () LC3-II levels were analyzed by Western blot. Representative blots and densitometric quantifications are shown. Data = fold-change relative to normoxia (mean ± SEM, n ≥ 3). *< 0.05; ***< 0.001. a b p p
Summary
DHA mitigates hypoxia-induced apoptosis and oxidative stress by restoring autophagy gene expression and stimulating Beclin-1/LC3 signaling. Parallel protection by rapamycin supports autophagy induction as a key mechanism of DHA-mediated neuroprotection (Fig. 5).
Proposed mechanism of DHA-induced neuroprotection under hypoxia–reoxygenation stress. Hypoxia exacerbates neuronal injury by impairing oxidative phosphorylation and triggering oxidative stress, apoptosis, and suppression of autophagy. In this study, nerve growth factor-differentiated PC12 (NGFDPC12) cells exposed to 0.5% O₂ showed increased expression of the stress-response genesand, accumulation of reactive oxygen species (ROS), and upregulation of the oxidative stress marker. Pretreatment with docosahexaenoic acid (DHA) or the autophagy activator rapamycin markedly improved cell viability and reduced apoptosis. DHA restored the expression of autophagy-related genes (,,) suppressed by hypoxia and increased Beclin-1 phosphorylation and LC3 lipidation, consistent with enhanced autophagic activity. Together, these findings support a model in which DHA pretreatment induces mild ROS signaling that activates the AMPK–Beclin-1–LC3 pathway, promoting autophagy and reducing oxidative stress and apoptosis under hypoxia–reoxygenation stress. The illustration was generated with BioRender.com HIF-1α BNIP3 FABP5 Atg5 Atg7 Atg12
Discussion
This study identifies DHA as a powerful enhancer of autophagy that protects neuronal-like cells from hypoxic injury. Hypoxia (0.5% O₂) activates the canonical HIF-1α/BNIP3 pathway, increases ROS production, and triggers apoptosis in NGFDPC12 cells. DHA pretreatment restores autophagic gene expression, enhances Beclin-1 phosphorylation, and increases LC3 lipidation, thereby improving cell survival. Under normal oxygen levels, mitochondrial ROS are neutralized by antioxidant enzymes (Droge 2002). During hypoxia, ATP depletion weakens these defenses, and upon reoxygenation, NADPH oxidase activation further boosts ROS production (He et al. 2023; Trebak et al. 2010). Consistent with this mechanism, MCI-186 effectively reduces hypoxia-induced ROS in our model. The simultaneous upregulation of FABP5—a ROS-responsive lipid chaperone (Liu et al. 2015)—further confirms the oxidative stress in hypoxic NGFDPC12 cells.
Autophagy and apoptosis share molecular components and often act antagonistically to determine cell fate (Bellot et al. 2009; Gu et al. 2015). BNIP3, induced by HIF-1α, controls this cross-talk by releasing Beclin-1 from Bcl-2/Bcl-xL inhibition, thus activating autophagy (Li et al. 2021; Zhang and Ney 2009). In our experiments, hypoxia suppressed Beclin-1 phosphorylation and LC3-II formation, indicating impaired autophagy. DHA restored both, suggesting a shift toward autophagic survival signaling. The upregulation of Atg5, Atg7, and Atg12 further supports DHA’s role in maintaining the autophagic machinery during metabolic stress. Interestingly, DHA increased Beclin-1 phosphorylation and LC3-II even under normoxia, implying that it primes autophagy. DHA has been shown to activate AMPK in neural tissues (Datilo et al. 2023), which phosphorylates Beclin-1 at Ser93/96 to stimulate autophagy initiation. We propose that DHA generates a mild redox signal that engages AMPK–Beclin-1 pathways, establishing a preconditioned state that enhances resilience to subsequent hypoxic stress. Low-level ROS production can serve as a beneficial signal for homeostatic adaptation (Miller et al. 2019; Redza-Dutordoir et al. 2016), supporting this hypothesis.
Although the experiments reported in this study were conducted in differentiated PC12 cells, which do not form glutamatergic synapses that are important mediators of neuronal injury under hypoxia/reperfusion conditions, the cellular mechanisms identified may still have clinical relevance. In diabetic neuropathy, chronic hyperglycemia and microvascular dysfunction lead to reduced endoneurial oxygenation and axonal degeneration (McMillan 1984; Nukada 2014). Structural changes in the microvasculature—such as basement-membrane thickening, pericyte loss, and endothelial proliferation—hinder oxygen delivery (Cho et al. 2008; Taylor 2001), making diabetic nerves more susceptible to ischemic injury (Nukada et al. 2011; Wang et al. 2004). Our prior clinical studies showed that DHA supplementation alleviates neuropathic pain and decreases circulating markers of oxidative and necroptotic stress (Duran et al. 2019, 2022). The current findings support these observations mechanistically by showing that DHA enhances autophagic flux and reduces hypoxia-induced cell death. In conclusion, DHA restores autophagic capacity, boosts Beclin-1 activation, and decreases oxidative and apoptotic stress in neuronal-like cells. These results highlight autophagy induction as a key mechanism of DHA-supported neuroprotection, endorsing the therapeutic potential of ω-3 fatty acids in ischemic and metabolic neuropathies. Future research involving autophagic flux reporters, AMPK inhibitors, and in vivo models of cerebral or peripheral ischemia is essential to further elucidate this pathway. Accordingly, future studies should confirm these findings in primary neuronal cultures and, ideally, in vivo models to enhance their physiological relevance.
Supplementary Information
Below is the link to the electronic supplementary material.
Supplementary Material 1 (DOCX 315 KB)