End-of-life targeted degradation of DAF-2 insulin/IGF-1 receptor promotes longevity free from growth-related pathologies

To monitor and conditionally regulate protein levels of the C. elegans DAF-2 insulin/IGF-1 receptor, we introduced a degron::3xFLAG tag into the 3' end of the daf-2 open reading frame (Figure 1—figure supplement 1). This degron::3xFLAG insertion into the genome was designed to tag the DAF-2 receptor at the cytosolic part for two reasons: first, to minimize any interference by the 81-amino acids large degron::3xFLAG-tag with the DAF-2 receptor function; and second, to ensure accessibility of the degron for targeted degradation by the TIR1 ubiquitin ligase expressed in the cytoplasm (Figure 1A). We endogenously tagged the DAF-2 receptor using CRISPR, and the resulting daf-2(bch40) CRISPR allele was verified by PCR (Figure 1—figure supplement 1). We performed western blot analysis against the 3xFLAG-tag and detected a specific band in daf-2(bch40) animals. This band was absent in wild type (N2) and animals carrying only the eft-3p::TIR1::mRuby::unc-54 3'UTR transgene (Figure 1B), which expresses TIR1 in all somatic cells, including neurons (Tomioka et al., 2016). To promote degradation of the degron::3xFLAG-tagged DAF-2 receptor, we crossed daf-2(bch40) into TIR1-expressing C. elegans. The strain obtained from this cross will be called ‘DAF-2::degron’ throughout this paper (i.e., Si57 [Peft-3::TIR1::mRuby::unc-54 3'UTR+ Cbr-unc-119(+)] II; daf-2(bch40 [degron::3xFLAG::STOP::SL2-SV40-degron::wrmScarlet-egl-13 NLS]) III). This strain showed no obvious phenotypes and exhibited a normal developmental progression at 20°C (Figure 1—figure supplement 1). To verify whether the band from the western blot was indeed DAF-2::degron::3xFLAG, we treated DAF-2::degron animals with daf-2 RNAi. The band nearly completely disappeared after 48 hr of daf-2(RNAi) feeding (Figure 1C and D, Source data 1 and Source data 2). Collectively, these results suggested that the tagged transmembrane receptor DAF-2 did not interfere with normal DAF-2 function.

Next, we monitored endogenous DAF-2 protein levels under different environmental conditions, such as temperature and diet. Previously, Kimura and colleagues used DAF-2 antibody immunostaining of whole animals and reported that mutant DAF-2(e1370) protein is present at 15°C but barely detected at 25°C, whereas mutant DAF-2(e1370) protein in a daf-16 null background or wild-type DAF-2 protein persists at both 15°C and 25°C (Kimura et al., 2011). By contrast, upon 24 hr of starvation, the DAF-2 receptor is no longer detectable by using immunofluorescence in fixed C. elegans (Kimura et al., 2011). Since the FOXO transcription factor daf-16 is the transcriptional output of daf-2 signaling (Ewald et al., 2018; Gems et al., 1998), these results suggest that DAF-2 protein levels may be autoregulated by IIS and might be influenced by temperature and food availability. We first asked whether our DAF-2::degron::3xFLAG tag allows quantification of endogenous DAF-2 levels. We observed comparable wild-type DAF-2::degron::3xFLAG levels across a range of temperatures (15–28°C; Figure 1E), indicating that temperature does not influence DAF-2 levels in wild type. Intriguingly, however, we found that using FLAG-HRP antibodies to monitor protein levels, DAF-2 protein almost completely disappeared after 36–48 hr of starvation (Figure 1F and G). In keeping with this result, well-fed animals, for which we added 1% glucose into the bacterial diet (OP50), increased the DAF-2 protein levels (Figure 1F and G). Curiously, we noted that this starvation-induced degradation of DAF-2 did not happen when, during development, C. elegans were fed another bacterial strain, HT1115, used for RNAi (L4440). When DAF-2::degron animals were grown on L4440 and then shifted on empty NGM plates for 24 or 48 hr of starvation, DAF-2 levels did not decrease (Figure 1H). This observation suggests a hypothesis that the nutritional composition of the animal’s diet prior to starvation influences DAF-2 stability, which will be interesting to test in future research. We conclude that food availability controls not only the secretion of insulin-like peptides to regulate DAF-2 activity (Pierce et al., 2001) but also DAF-2 receptor abundance.

In C. elegans, cytosolic degron-tagged proteins are almost completely degraded after 30 min of auxin treatment (Zhang et al., 2015). However, the degradation of transmembrane proteins using AID in vivo has not been previously reported. We hypothesized that C. elegans might exhibit similar kinetics of degradation of a transmembrane protein following auxin treatment. In keeping with that hypothesis, after 30 min of 1 mM auxin treatment, we observed a dramatic decrease in transmembrane DAF-2 protein abundance (Figure 1I and J). Levels of DAF-2 were only slightly further reduced by continued auxin treatment, as indicated at 4 and 24 hr time points (Figure 1I and J). After 24 hr of 1 mM auxin treatment, we observed only a 40% total decrease in DAF-2 protein abundance rather than a complete loss (Figure 1C and D). Similar kinetics in the degradation of DAF-2::degron::3xFLAG levels were confirmed using additional FLAG and degron antibodies (Source data 2). Taken together, these results suggest that our AID system allows for the partial, rapid degradation of the transmembrane DAF-2 receptor.

We wondered whether the reduction of DAF-2 levels by AID would have consequences consistent with reduced IIS. Activation of DAF-2/insulin/IGF-1 receptor induces a downstream kinase cascade to phosphorylate the transcription factors DAF-16/FOXO and SKN-1/NRF, causing their retention in the cytoplasm (Figure 2A; Ewald et al., 2015; Henderson and Johnson, 2001; Lin et al., 2001; Murphy et al., 2003; Ogg et al., 1997; Tullet et al., 2008). Genetic inhibition of daf-2 results in less DAF-16 and SKN-1 phosphorylation and promotes nuclear translocation to induce the expression of target genes, such as sod-3 (superoxide dismutase) and gst-4 (glutathione S-transferase), respectively (Ewald et al., 2015; Henderson and Johnson, 2001; Lin et al., 2001; Murphy et al., 2003; Tullet et al., 2008). Within 1 hr of 1 mM auxin treatment, we found that most DAF-16::GFP translocated into the nuclei in DAF-2::degron animals (Figure 2B), with observable translocation already after 30 min (Figure 2—figure supplement 1). This DAF-16::GFP nuclear localization in DAF-2::degron animals was time- and auxin-concentration-dependent and did not occur in DAF-16::GFP animals with wild-type DAF-2 (Figure 2B, Figure 2—figure supplement 1). Similarly, SKN-1- or DAF-16-target gene expression of gst-4 or sod-3 was only induced upon auxin treatment in DAF-2::degron animals (Figure 2C and D). Thus, expectedly, IIS is reduced upon AID DAF-2 degradation.

Reduced IIS during development promotes dauer entry. Dauer formation at 15°C has been observed for a variety of strong loss-of-function daf-2 alleles, such as the class I alleles e1369 and m212, the class II allele e979, the null alleles m65, m646, m633, and a variety of unclassified alleles discovered by Malone and Thomas (Gems et al., 1998; Kimura et al., 2011; Malone and Thomas, 1994; Patel et al., 2008). For the commonly used reference alleles e1368 and e1370, penetrant dauer formation only occurs at 25°C (Gems et al., 1998). By contrast, knockdown of daf-2 by RNAi does not cause dauer formation at any temperature (Dillin et al., 2002; Ewald et al., 2015; Kennedy et al., 2004). We hypothesized that dauer formation would not happen because the decrease of DAF-2::degron levels after auxin treatment is only around 40%. However, synchronized L1 treated with 0.1 or 1 mM auxin all formed dauers at 25°C (Figure 2E and F). We observed dose-dependent retardation of the developmental speed when using lower auxin concentrations (1, 10, and 50 μM), but the offspring of retarded animals, grown on plates containing auxin, became dauers (Figure 2E and F). The dependence on auxin concentration for dauer formation of L1 animals suggests a threshold of DAF-2 receptor levels for the decision or commitment to dauer diapause. Even more surprising was the observation that dauer formation was also observed at 15°C and 20°C with complete penetrance (Figure 2G and H). We found that dauer formation was related to the developmental speed at a given temperature: At 15°C, it took 6 days; at 20°C, it took 4 days; and at 25°C, it took 3 days to form dauers (Figure 2H). We verified that all auxin-induced DAF-2::degron dauers showed dauer-specific characteristics, such as SDS resistance, cessation of feeding, constricted pharynxes, and dauer-specific alae (Figure 2G, Figure 2—figure supplement 1), suggesting a complete dauer transformation. Thus, the AID of DAF-2 promotes complete dauer formation independent of temperature but dependent on DAF-2 protein abundance.

Wild-type animals enter the pre-dauer L2d stage, where they keep monitoring their environment before completely committing to dauer formation (Golden and Riddle, 1984; Hu, 2007; Karp, 2018). Treating wild type with dauer pheromone suggested mid-L1 as the stage when the dauer decision is made (Golden and Riddle, 1984). By contrast, previous temperature-shifting experiments (from 15°C to 25°C) with daf-2 mutants suggested a dauer decision time window from L1 to L2 stage, before the L2d stage (Swanson and Riddle, 1981). Since AID allows for precise temporal degradation of DAF-2, we pinpointed the dauer entry decision to the mid-L1 stage. Specifically, we shifted synchronized L1s at different time points to plates containing 1 mM auxin and counted the number of cells in developing gonads to determine the developmental stage, when 50% of the population committed to becoming dauers (Figure 3—figure supplement 1). We found that when DAF-2 levels are below a given threshold at the mid-L1 stage, the animals commit to becoming dauers.

The FOXO transcription factor DAF-16 is required for dauer formation in daf-2 mutants. We crossed DAF-2::degron with DAF-16::degron (Aghayeva et al., 2021) and found that daf-16 was required for dauer formation and developmental speed alterations after DAF-2::degron depletion (Figure 2—figure supplement 2). Previous reports suggest that many daf-2 alleles show low to severe penetrance of embryonic lethality and L1 arrest at higher temperatures (Collins et al., 2008; Ewald et al., 2016; Gems et al., 1998; Patel et al., 2008). Although the constitutive dauer formation of the proposed null allele daf-2(m65) is suppressed by daf-16 null mutations, the embryonic lethality and L1 arrest are not daf-16-dependent (Patel et al., 2008). We observed no embryonic lethality nor L1 arrest in the progeny of animals placed on 1 mM auxin as L4s. Similar results were seen using either the DAF-2::degron or DAF-2::degron; germline TIR1 strains. Higher concentrations of auxin lead to toxicity in both wild-type and DAF-2::degron animals (Figure 2—figure supplement 2). A lack of embryonic lethality could be explained by insufficient DAF-2 degradation or earlier decision stages. Taken together, the inactivation of DAF-2 by AID is 100% penetrant for dauer formation at any temperature. Still, the absence of embryonic lethality or L1 arrest at 1 mM auxin suggests that DAF-2::degron functionally is more similar to a non-conditional and severe loss-of-function mutation than a null allele.

Given the strong phenotypic effects of DAF-2 AID on animal development, we next explored whether DAF-2 degradation by AID could affect the function of adult animals. Previous studies indicate that reducing IIS, either by daf-2 RNAi knockdown or in genetic mutants, increases lifespan at any temperature (15–25°C) (Ewald et al., 2018; Gems et al., 1998). We hypothesized that AID-dependent degradation of DAF-2 would have similar effects on the lifespan of animals. We found that auxin supplementation of DAF-2::degron animals, starting from L4, resulted in a 70–135% lifespan extension (Figure 3A; Supplementary file 1). Impressively, DAF-2 degradation using 1 mM auxin surpassed the longevity of commonly used daf-2(e1368) and daf-2(e1370) mutants (Figure 3A, Supplementary file 1). By contrast, auxin treatment at 0.1 or 1 mM concentration had little or no effect on wild-type lifespan (Figure 3A; Supplementary file 1). These results suggest that auxin-induced degradation of daf-2 is a powerful tool to promote longevity.

Although reducing daf-2 function causes beneficial increases in longevity and stress resistance, it causes residual detrimental phenotypes in adult animals that resemble the behavioral and morphologic changes reminiscent of developing animals remodeling to enter the dauer state (Ewald et al., 2018; Gems et al., 1998). In class II daf-2 alleles, these phenotypes, such as small gonads, reduced brood size, reduced motility, and reduced brood size, manifest only at 25°C during adulthood but not at lower temperatures (Ewald et al., 2018; Gems et al., 1998). To determine whether DAF-2::degron AID animals display daf-2 class II mutant phenotypes, we quantified these characteristics at 15°C and 25°C. In placing L4 DAF-2::degron animals on auxin and at 25°C, we observed similar levels of egg retention and effects on gonad size as was seen in the daf-2(e1370) class II allele. Strikingly, these effects were temperature-dependent, as DAF-2::degron animals did not retain eggs or had reduced gonad sizes at 15°C (Figure 3B, Figure 3—figure supplement 1). Similarly, DAF-2::degron animals on auxin exhibited germline shrinkage at 25°C, albeit to a lesser degree than the daf-2(e1370) class II allele (Figure 3C, Figure 3—figure supplement 1). This phenotype was also absent at 15°C, suggesting that egg retention and germline shrinkage are temperature-sensitive traits.

Another known daf-2 class II mutant phenotype at 25°C is the quiescence or immobility of class II daf-2(e1370) mutants (Ewald et al., 2018; Gems et al., 1998). We did not observe any immobility of auxin-treated DAF-2::degron animals at 25°C or during lifespan assays at 20°C (Video 1, Supplementary file 2). Although the effects on body size of daf-2(e1370) class II allele are temperature-dependent, presenting at 25°C but not at 15°C (Ewald et al., 2015; Gems et al., 1998; McCulloch and Gems, 2003; Figure 3—figure supplement 1), auxin-induced degradation of DAF-2 starting from L4 shortened body size of 2-day-old adults at both temperatures (Figure 3D, Figure 3—figure supplement 1). Similarly, while daf-2(e1370) mutants only exhibit reduced brood sizes at higher temperatures (Ewald et al., 2018; Gems et al., 1998), AID of DAF-2::degron starting from L4 reduced brood size at both 15°C and 25°C (Figure 3E). This suggests that smaller body and brood size manifest as non-conditional traits, in keeping with insulin/IGF-1’s role as an essential gene for these functions. In summary, these results suggest that some daf-2 class II mutant phenotypes, or pathologies, can be induced during adulthood independent of temperature and that passing through the L2d stage is not required for the daf-2 class II mutant phenotypes to emerge in adult animals.

The pleiotropic effects of DAF-2 have been ascribed to tissue-specific functions of DAF-2. DAF-2 protein levels are predominantly found in the nervous system and intestine, and to a lesser extent in the hypodermis (Kimura et al., 2011), while daf-2 mRNA expression has also been detected in the germline (Han et al., 2017; Lopez et al., 2013). Mosaic loss of daf-2 in different cell lineages indicated neurons as crucial tissue to control dauer formation non-cell autonomously (Apfeld and Kenyon, 1998). Moreover, dauer formation in daf-2(e1370) can be restored by expressing wild-type DAF-2 only in neurons (Wolkow et al., 2000). Thus, we hypothesized that select tissues might drive the daf-2 class II mutant phenotypes. To test this, we expressed TIR1 specifically in muscles, neurons, and intestine, driven by the myo-3, rab-3, and vha-6 promoters, respectively (Materials and methods, Supplementary file 2). TIR1 expressed from any of these three tissue-specific promoters did not result in reduced body size (Figure 4E and Figure 3—figure supplement 1E). To validate that the neuronal TIR1 was functional, we crossed neuronal TIR1 into daf-16(ot853 [daf-16::linker::mNG::3xFLAG::AID]) (Aghayeva et al., 2021) and observed that DAF-16::mNG was selectively degraded in neurons upon auxin treatment (Figure 3—figure supplement 2). Nonetheless, we found that depletion of DAF-2 in neurons caused egg retention and germline shrinkage (Figure 3F and G). Interestingly, the germline shrinkage and egg retention phenotypes were temperature-dependent, suggesting some interaction of temperature and neuronal DAF-2 abundance. Thus, some daf-2-phenotypes appear to emerge from a single tissue, whereas others might be due to an interplay between several tissues.

Previously, transgenic expression of wild-type copies of DAF-2 in neuronal or intestinal cells was shown to partially suppress the longevity of daf-2(e1370) mutants at 25°C (Wolkow et al., 2000). Taking advantage of our unique AID system, we wanted to test whether the degradation of DAF-2 in a single tissue is sufficient to induce longevity. We found that either neuronal or intestinal depletion of DAF-2 was alone sufficient to extend lifespan, although not to the extent as when DAF-2 is degraded in all tissues (Figure 4A; Supplementary file 1). Therefore, we asked whether tissue-specific DAF-2 degradation was also sufficient for stress resistance seen in daf-2 mutant animals (Ewald et al., 2018; Gems et al., 1998). Auxin-induced degradation of DAF-2 in all tissues resulted in increased oxidative stress resistance, comparable to daf-2(e1370) mutants (Figure 4B). We observed improved oxidative stress resistance when we depleted DAF-2 in the intestine but not in neurons (Figure 4C and D, Figure 3—figure supplement 2). This implies that reducing DAF-2 levels, specifically in the intestine, promotes longevity and stress resistance without causing dauer-like phenotypes.

We have previously shown that the transcription factor SKN-1/NRF1,2,3 is localized in the nucleus at 15°C or 25°C in daf-2(e1370) mutants (Ewald et al., 2015), suggesting that SKN-1 activation occurs under reduced insulin/IGF-1 receptor signaling conditions (Tullet et al., 2008). Intriguingly, skn-1 activity is necessary for full lifespan extension of daf-2(e1370) mutants only at 15°C but not at 25°C (Ewald et al., 2015). We hypothesized that skn-1 requirements for lifespan extension are masked when dauer-like reprogramming conditions are triggered at higher temperatures (Ewald et al., 2018). Because auxin-treated DAF-2::degron AID animals exhibit daf-2 class II mutant traits during adulthood at 15°C, we asked whether the lifespan extension caused by DAF-2::degron AID upon auxin treatment at 15°C is skn-1-independent. We found that the lifespan extension in DAF-2::degron animals fully required skn-1 at 15°C. Surprisingly, however, a loss of skn-1 extended the median lifespan of DAF-2::degron animals at 25°C (Figure 4E and F; Supplementary file 1). This suggests that skn-1 may function independently from dauer-like reprogramming pathways at 15°C. Furthermore, the increased longevity seen in DAF-2::degron animals may result from a differential transcriptional program at higher temperatures compared to lower temperatures.

Finally, we asked whether it would be possible to promote longevity in geriatric animals by depleting DAF-2 by AID. Previous studies using RNAi indicated that reduced daf-2 expression extended lifespan when started at day 6 of adulthood but not later (Dillin et al., 2002), raising the question of whether daf-2-longevity induction is possible beyond the reproductive period (days 1–8 of adulthood). To address this, we maintained DAF-2::degron animals on control plates and shifted them to 1 mM auxin-containing plates at day 0 (L4), and up to day 20 of adulthood (Figure 5A). We found that shifting the animals past the reproductive period at day 10 and day 12 still led to an increase in lifespan by 48–72% and 49–57%, respectively (Figure 5A, Supplementary file 1). Since transferring old C. elegans to culturing plates without bacterial food can also increase lifespan past reproduction (Smith et al., 2008), we decided to top-coat lifespan plates with auxin late in life. We observed lifespan extension of animals by supplementing auxin very late during lifespan at day 21 or 25 of adulthood, at a time at which already approximately 50–75% of the population had died (Figure 5B–D, Supplementary file 1). Remarkably, AID of DAF-2 doubled the lifespan of these animals at this late stage (Figure 5A–D, Supplementary file 1). For example, when about three-quarters of the population had ceased by day 21 (Figure 5B) or day 25 (Figure 5D), and control-treated DAF-2::degron animals lived for just another 4 or 7 days, the auxin-treated DAF-2::degron animals lived for another 26 or 43 days, respectively (Figure 5B and D, Supplementary file 1). This demonstrates that reducing insulin/IGF-1 receptor signaling is feasible in geriatric C. elegans. Thus, our approach to selectively reduce DAF-2 protein in old animals suggests that targeting the daf-2 signaling pathway late in life may be an effective strategy to extend lifespan.

All strains were maintained on NGM plates and OP50 Escherichia coli at 15°C as described. The strains and primers used in this study can be found in Supplementary file 3.

Statistical analysis was either done by using RStudio or Excel. All plots have been made using RStudio (1.2.5001). The packages ggplot2, survminer, dplyr were required for some plots.

Auxin (indole-3-acetic acid, Sigma #I3750) was dissolved in DMSO to prepare a 400 mM stock solution and stored at 4°C. Auxin was added to NGM agar that has cooled down to about 60°C before pouring the plates (Zhang et al., 2015). For lower concentrations (1 μM and 10 μM), the 400 mM stock dilution was further diluted in DMSO. Control plates contained the same amount of DMSO (0.25% for 1 mM auxin plates). For lifespans, plates were supplemented with FUdR to the final concentration of 50 μM.

The sgRNA targeting the terminal exon of the annotated daf-2 isoform a, 5’ (G)TTTGGGGGTTTCAGACAAG 3’ was cloned into the PU6:: sgRNA (F + E) plasmid backbone, pIK198 (Katic et al., 2015), yielding plasmid pIK323. The initial guanine was added to aid the transcription of the sgRNA. The underlined nucleotides in the sgRNA correspond to the stop codon of the DAF-2(A) protein.

The CRISPR tag repair template pIK325 degron::3xFLAG::SL2::SV40::NLS::degron::wrmscarlet::egl-13 NLS was assembled using the SapTrap method (Schwartz and Jorgensen, 2016) from the following plasmids: pMLS257 (repair template-only destination vector), pIK320 (wrmscarlet::syntron-embedded LoxP-flanked, reverse Cbr-unc-119), pMLS285 (egl-13 NLS N-tagging connector), pIK321 (linker::auxin degron::3XFLAG::SL2 operon::SV40 NLS::linker::auxin degron C-tagging connector), and phosphorylated pairs of hybridized oligonucleotides oIK1182 5’TGGTCGGCTTTCGGTGAAAATGAGCATCTAATCGAGGATAATGAGCATCATCCACTTGTC 3’, oIK1183 5’CGCGACAAGTGGATGATGCTCATTATCCTCGATTAGATGCTCATTTTCACCGAAAGCCGA 3’, and oIK1184 5’ACGAACCCCCAAAAAATCCCGCCTCTTAAATTATAAATTATCTCCCACATTATCATATCT 3’, oIK1185 5’TACAGATATGATAATGTGGGAGATAATTTATAATTTAAGAGGCGGGATTTTTTGGGGGTT 3’, respectively. Modules pIK320 and pIK321 (this study), compatible with the SapTrap kit, were assembled through a combination of synthetic DNA (Integrated DNA technologies) and molecular cloning methods. EG4322 ttTi5605; unc-119(ed3) animals were injected with a mix consisting of the sgRNA pIK323 at 65 ng/ml, tag repair template pIK325 at 50 ng/ml, pIK155 Peft-3::Cas9::tbb-2 3’UTR at 25 ng/ml and fluorescent markers pIK127 Peft-3::GFP::h2b::tbb-2 3’UTR at 20 ng/ml, and Pmyo-3::GFP at 10 ng/ml. Among the non-Unc F2 progeny of the injected animals not labeled with green fluorescence were correctly tagged daf-2(bch40 [degron::3xFLAG::SL2::SV40 NLS::degron::wrmscarlet::egl-13 NLS]) animals. We were able to recover two independent CRISPR alleles daf-2(bch39) and daf-2(bch40).

pIK280 (TIR1::mRuby::tbb-2 in a MosSCI-compatible backbone) (Frøkjær-Jensen et al., 2012; Frøkjaer-Jensen et al., 2008) was created by Gibson assembly (Gibson et al., 2009) from templates including pLZ31 (Zhang et al., 2015). Promoter regions were inserted by Gibson assembly of PCR products into pIK280 to express TIR-1::mRuby in different tissues. Such plasmids were injected into EG4322 ttTi5605; unc-119(ed3) animals (Frøkjær-Jensen et al., 2012). The strains are IFM160 bchSi59 [Pmyo-3::TIR1::mRuby::tbb-2] II; unc-119(ed3), IFM161 bchSi60 [Pvha-6::TIR1::mRuby::tbb-2] II; unc-119(ed3), and IFM164 bchSi64 [Prab-3::TIR1::mRuby::tbb-2] II; unc-119(ed3).

RNAi bacteria cultures were grown overnight in LB with carbenicillin (100 µg/ml) and tetracycline (12.5 µg/ml), diluted to an OD₆₀₀ of 1, and induced with 1 mM IPTG and spread onto NGM plates containing tetracycline (12.5 µg/ml) and ampicillin (50 µg/ml) as described in Ewald et al., 2017b. Plasmid pL4440 was used as an empty RNAi vector (EV) control. The daf-2(RNAi) clone was a kind gift from the Blackwell lab and was sequenced for validation.

Synchronized C. elegans, on their first day of adulthood, were shifted to auxin plates for different time points. About 2000–5000 adult C. elegans per condition were disrupted using beads in lysis buffer (RIPA buffer [ThermoFisher #89900]), 20 mM sodium fluoride (Sigma #67414), 2 mM sodium orthovanadate (Sigma #450243), and protease inhibitor (Roche #04693116001) and kept on ice for 15 min before being centrifuged for 10 min at 15,000 × g. For equal loading, the protein concentration of the supernatant was determined with BioRad DC protein assay kit II (#5000116) and standard curve with Albumin (Pierce #23210). Samples were boiled at 37°C for 30 min, shortly spun down, and 40 μg of protein was loaded onto NuPAGE Bis-Tris 10% Protein Gels (ThermoFisher #NP0301BOX), and proteins were transferred to nitrocellulose membranes (Sigma #GE10600002). Western blot analysis was performed under standard conditions with antibodies against Tubulin (Sigma #T9026, 1:1000) (Sigma #F3165, 1:1000), FLAG-HRP (Sigma #A8592, 1:1000), and Degron (MBL #M214-3, 1:1000). HRP-conjugated goat anti-mouse (Cell Signaling #7076, 1:2000) secondary antibodies were used to detect the proteins by enhanced chemiluminescence (Bio-Rad #1705061). Quantification of protein levels was determined using ImageJ software and normalized to loading control (Tubulin). Statistical analysis was performed using either a two-tailed or one-tailed t-test. All western blots and quantifications can be found in Source data 1 and Source data 2.

Transgenic daf-16::gfp; DAF-2::degron C. elegans were grown on plates for the indicated length of time supplemented with the corresponding concentration auxin at 20°C. For image acquisition, the animals were placed on freshly made 2% agar pads and anesthetized with tetramisole (Teuscher and Ewald, 2018). Images were taken with an upright bright-field fluorescence microscope (Tritech Research, model: BX-51-F) and a camera of the model DFK 23↗U↗×↗236↗ (Teuscher and Ewald, 2018). For quantification, the animals were observed under a fluorescent stereomicroscope after the indicated amount of time has passed. sod-3p::gfp and gst-4p::gfp animals were incubated overnight at 20°C and quantified the next morning. L4 larvae were used for quantification. Statistical analysis was performed by using Fisher’s exact test for daf-16::gfp and gst-4::gfp and two-tailed t-test for sod-3::gfp. The DMSO control was compared to the ones treated with various concentrations of auxin.

As described in Ewald et al., 2012, L4 C. elegans of wild-type N2 and DAF-2::degron were picked to plates at 15°C. After 2 days, the adult animals were shifted to new plates and were allowed to lay eggs for 2 hr. The stage of the offspring and their health was assayed 4 days later at 20°C. Statistical analysis was performed by using a two-tailed t-test.

Synchronized L1 C. elegans were put on 1 mM auxin plates and incubated at 15°C, 20°C, and 25°C. At the indicated time points, the animals were washed off with M9, shortly centrifuged down, and SDS was added for a final concentration of 1%. After 10 min of gentle agitation, the animals were put on plates and checked for survival.

Adult C. elegans were placed on 1 mM auxin plates (for ‘DAF-2::degron’) or DMSO plates (for ‘DAF-2::degron’, daf-2(e1368) and daf-2(e1370)) and shifted to 25°C. Dauer-like offspring or size-matching controls were picked after 4 days, anesthetized in 10 mM sodium azide, and mounted on 2% agarose pads. Images were taken at 40× magnification using an inverted microscope (Tritech Research, MINJ-1000-CUST) and a camera of the model DFK 23↗U↗×↗236↗.

Adult C. elegans were put on 1 mM auxin plates, or DMSO plate seeded with OP50 containing a 1:100 dilution of red fluorescent latex bead solution (Sigma #L3280) and shifted to 25°C. Dauer offspring and control L2/L3 larvae on the bacterial lawn were picked after 4 days, anesthetized in 10 mM sodium azide, and mounted on 2% agarose pads. An upright bright-field fluorescence microscope (Tritech Research, model: BX-51-F) and a camera of the model DFK 23U × 236 were used for image acquisition. The presence of beads in the intestine was checked at 20× magnification. A two-tailed t-test was used for analysis.

Bleached eggs were synchronized for 2 days at 20°C in an M9 buffer supplemented with 5 μg/ml cholesterol to yield a highly synchronous L1 population (Teuscher et al., 2019). The synchronized L1 larvae were put on OP50 NGM plates and then switched to plates containing 1 mM auxin at different time points. Dauer and non-dauer animals were counted after 2 days at 25°C or 3 days at 20°C.

Bleached eggs were synchronized for 2 days at 20°C in M9 buffer supplemented with 5 μg/ml cholesterol to yield a highly synchronous L1 population (Teuscher et al., 2019). The larvae were put on OP50 NGM plates for 24–25 hr, washed off and anesthetized with 0.25 mM tetramisole, and mounted on 2% agarose pads. An upright bright-field fluorescence microscope (Tritech Research, model: BX-51-F) was used to count the cells in the developing gonad. Freshly hatched L1 have two germ stem cells (Z2-3), and L2 have, on average, 16 germ stem cells (Mainpal et al., 2015). However, we counted all visible cells in the gonad (i.e., both somatic and germ cells), which are four for the freshly hatched L1 (Z1-4) and 22 for animals around the L1/L2 transition (Hubbard and Greenstein, 2000). We relied on the characteristic round shapes of germ cells (Altun and Hall, 2002) (https://www.wormatlas.org/hermaphrodite/somatic%20gonad/Images/somaticfig3leg.htm↗). Using these criteria, we might have included DTC and other cells inside the gonad.

L4 C. elegans maintained at 15°C were picked on 1 mM auxin or control plates and shifted to the indicated temperatures. On the second day of adulthood, animals were mounted on 2% agar pads and anesthetized with 0.25 mM tetramisole. Images were taken at 40× magnification on an inverted microscope (Tritech Research, MINJ-1000-CUST) and a camera of the model DFK 23↗U↗×↗236↗. Statistical analysis was performed by using a two-tailed t-test for egg retention and Fisher’s exact test for germline morphology.

L4 C. elegans maintained at 15°C were picked on 1 mM auxin or control plates and shifted to the indicated temperatures. On the second day of adulthood, animals were mounted on 2% agar pads and anesthetized with 0.25 mM tetramisole. Images were taken at 10× magnification with an upright bright-field fluorescence microscope (Tritech Research, model: BX-51-F) and a camera of the model DFK 23U × 236. Body lengths were measured by placing a line through the middle of the body, starting from head to tail, using ImageJ 1.51 j. Statistical analysis was performed by using a two-tailed t-test.

L4 C. elegans maintained at 15°C were picked on 1 mM auxin or control plates and shifted to the indicated temperatures. C. elegans were shifted when necessary to fresh plates, and the progeny was counted after 2 days of development. Animals that crawled off the plate, dug into the agar, or bagged precociously were censored. Statistical analysis was performed by using a two-tailed t-test.

Synchronized L1 C. elegans were cultured at 15°C or 20°C on OP50 and shifted at the L4 stage to NGM plates containing 50 μM FUdR and auxin or DMSO. Bursted, dried out, or escaped animals were censored, and animals were considered dead when they failed to respond to touch and did not show any pharyngeal pumping. For late-life auxin lifespan assays: L4 C. elegans were picked onto NGM plates containing 50 μM FUdR. At day 20 or 25 of adulthood, plates were top-coated either DMSO or auxin to reach a final concentration of 0.25% DMSO or 1 mM auxin with 0.25% DMSO. Log-rank was used for statistical analysis. The plots were made by using the R-package survminer or JMP 14.1. All statistics can be found in Supplementary file 1.

Oxidative stress assay was modified from Ewald et al., 2017a. C. elegans of the L1 or L4 stage were shifted to auxin or DMSO plates, washed off at the indicated time point, incubated with 5 mM sodium arsenite in U-shaped 96-well plates, and put into the wMicroTracker (MTK100) for movement scoring. For statistical analysis, the area under the curve was measured, and the mean for each run was calculated. Statistical analysis was performed by using a paired sample t-test. All plots can be found in Supplementary file 2.