What this is
- Human umbilical cord mesenchymal stem cell-derived (hucMSCs-EX) influence .
- This study explores how hucMSCs-EX modulate macrophage responses in inflammatory environments.
- Key findings include the enhancement of M2 macrophage markers and the suppression of pro-inflammatory signals.
Essence
- hucMSCs-EX promote macrophage transition to the M2 phenotype by inhibiting NF-κB signaling and activating STAT3 pathways, suggesting their potential as anti-inflammatory agents.
Key takeaways
- hucMSCs-EX significantly increased IL-10 and Arg-1 levels while decreasing IL-6 and TNF-α in LPS-stimulated macrophages, indicating a shift towards anti-inflammatory signaling.
- The enhanced CD206 expression, a marker for M2 macrophages, and promoted the proliferation and migration of LPS-induced RAW264.7 cells.
- hucMSCs-EX inhibited the activation of the NF-κB p65 pathway while stimulating the STAT3 pathway, linking these mechanisms to M2 .
Caveats
- The study primarily utilizes in vitro models, which may limit the generalizability of the findings to in vivo conditions.
- Further research is needed to fully elucidate the mechanisms by which hucMSCs-EX influence .
Definitions
- Macrophage polarization: The process by which macrophages adopt different functional states (M1 or M2) based on environmental cues.
- Exosomes: Small extracellular vesicles that facilitate intercellular communication by transferring proteins, lipids, and RNAs between cells.
AI simplified
INTRODUCTION
Macrophages have a crucial role in the immune responses against several clinical diseases, such as viral and autoimmune diseases [1, 2]. In tissues, circulating blood monocytes differentiate into macrophages and remain distinct phenotypic changes that correspond to the different phases of inflammation, namely, M1 macrophages that are classically activated and promote inflammation and M2 macrophages that are alternatively activated [3]. Moreover, M1 and M2 macrophages can interconvert under different environmental conditions. There is growing evidence indicating that M1 macrophages predominate in the blood vessels around inflammatory wound tissues. They can be recruited by Interferon-γ (IFN-γ)/LPS to secrete cytokines such as IL-1β, IL-6, TNF-α and IFN-γ. Moreover, M2 macrophages hold predominantly anti-inflammatory characteristics and have a role in the alleviation of inflammation [4]. They substantially suppress inflammation by upregulation of Arg-1 and IL-10. They also participate in tissue remodeling and angiogenesis [5]. Plasticity and diversity are two of the most distinguishing features of macrophages. The various polarization phenotypes of macrophages have a crucial role in maintaining homeostasis and influencing the development, progression, and other stages of inflammation [6, 7]. Therefore, directing the macrophage polarization towards either the M1 or M2 phenotype has appeared as a prospective therapeutic option for many inflammatory conditions [5, 8].
Multiple studies have revealed the possible involvement of mesenchymal stem cells (MSCs) in reducing inflammation, regulating the responses of immune cells, and aiding in the healing of different types of tissue injuries [9]. However, their application in clinical settings is constrained due to the tumorigenic characteristics of transplanted cells. Research has indicated that the therapeutic effects of MSCs primarily rely on their ability to secrete specific mediators via paracrine secretions, including lipids, proteins, mRNAs, and microRNAs encapsulated within exosomes [10]. MSCs-derived bio-active molecules/exosomes are closely interacted with immunocytes such as natural killer cells (NKCs), dendritic cells (DCs), lymphocytes, and macrophages. Exosomes are extracellular membrane vesicles (40 to 100 nm) that are secreted into the extracellular environment by multiple cell types, for instance, mast cells, DCs, reticulocytes, B and T cells, epithelial cells, MSCs, and tumor cells [11]. Once released, exosomes may enter biological fluids to facilitate the long-distance exchange of biological information mediated by exosomes [12]. Alternatively, they may remain close to their secretory cells. The cellular origin of exosomes dictates their composition [11]. Despite their source, exosomes contain several prominent proteins, including Alix3, CD9, and CD63 [13, 14]. Exosomes are important in local cell-to-cell communication and genetic information exchange by transferring membrane and cytosolic proteins, lipids, coding RNA, noncoding RNA, antigen-presenting molecules, and DNA between cells in the inflammatory microenvironment. Thus, they have the potential to influence the outcome of inflamed tissues [15, 16]. This study investigated the potential signaling pathways in which hucMSCs influence LPS-induced mouse RAW264.7 cells via their secreted exosomes. Results showed that hucMSCs-EX-co-cultured macrophages that were stimulated by LPS, were identified by reductions in TNF-α and IL-6 and increases in IL-10 [17] and Arg-1. Moreover, LPS-induced cells displayed enhanced proliferation and migration, and hucMSCs-EX upregulated the CD206 expression, a surface marker for the M2 macrophages. Importantly, the suppressive effect of hucMSCs-EX on LPS-induced phenotypic M1 polarization of macrophages was linked with the decreased level of the NF-κB pathway. In contrast, hucMSCs-EX-induced M2 macrophage polarization is associated with STAT3 pathway activation in RAW264.7 cells. The current study validates the promising prospects of hucMSCs-EX as a clinically viable anti-inflammatory therapy by modulating macrophage polarization.
MATERIALS AND METHODS
Extraction, Purification, and Confirmation of hucMSCs-EX
Previous methods were followed for the isolation and propagation of hucMSCs [18]. These cells (third passage) were differentiated into osteoblasts and adipocytes using respective induction media (Gibco Grand Island, NY, USA). Alizarin Red and Oil Red O stains were used to observe osteogenic and adipogenic differentiation. Exosomes (hucMSCs-EX) derived from a conditioned medium of hucMSCs (hucMSCs-CM) were isolated and purified as per the established protocols [19]. Briefly, hucMSCs were grown to 60% confluence, and were rinsed three times with PBS to remove any particle of fetal bovine serum (FBS, Invitrogen). Cells were continuously grown without serum and exosomes in RPMI-1640 medium (Invitrogen) for 48 h. This exhausted medium is considered a conditioned medium derived from hucMSCs (hucMSCs-CM). The medium was collected and distributed into two parts: one part of hucMSCs-CM was filtered via a 0.22 μm syringe filter (Millipore, USA) and kept at -80°C for further use. The second part of hucMSCs-CM was centrifuged (1000 × g, 20 min) to discard cell debris, followed by two re-centrifugations (2,000 × g and 10,000 × g, 20 min each). The supernatants were purified (100 kDa MWCO [Millipore, USA], 1,000 × g, 30 min). The purified mixture was placed on a cushion of 5 mL of 30% sucrose/D2O and ultracentrifuged using a Beckman Coulter Optima L-90K ultracentrifuge (100,000 × g, 90 min, 4°C) [11]. The fractions enriched with microvesicles were obtained and then mixed with PBS. This was followed by three centrifugations (1,000 × g, 30 min) with 100 kDa MWCO. Precipitates were resuspended in sterile PBS and centrifuged (3000 rpm, 10 min, 4°C). After adsorption of 20 μL of the purified hucMSCs-EX onto copper grids and incubation at 25°C for two min, the grids were stained for 10 min with 30 μg/L phosphotungstic acid (pH 6.8) at 25°C [11]. The sample was dried at 25°C and then examined via transmission electron microscope (TEM) (Olympus, Tokyo, Japan). The size and dispersion of hucMSCs-EX were quantified and examined using Nanosight NTA and the Zetasizer-Nano software. Finally, the purified hucMSCs-EX were extracted, filtered (0.22 μm), and then kept at -80°C for further use. Bichicondinic acid (BCA) was employed to determine the protein concentration of the isolated exosomes. The resulting value was then used to calculate the exosomes' concentration. Approximately 50 μg/mL exosomes were preserved at -80°C until use. Fresh umbilical cord tissues were collected from full-term newborn delivered through cesarean section after obtaining written consent from their parents [18]. The Ethics Committee of Bengbu Medical University, Bengbu, China, approved all the relevant experimental protocols.
Co-culture of Macrophages (RAW264.7) with hucMSCs-EX
The cell line (murine macrophage RAW264.7) was received from the Cell Bank of Shanghai, China. Cells in logarithmic growth were grown in RPMI-1640 with 10% FBS in the presence or absence of LPS (1 μg/mL) (5164948, Hangzhou, China) for 4 h. After incubation, cells were rinsed with PBS (thrice) and maintained in a complete medium (control), hucMSCs-CM (1:1 diluted while using a fresh medium), and 5 μg/mL hucMSCs-EX for 48 h in a 6-well dish. The propagated macrophages and resultant supernatants were obtained and stored for further experiments.
Gene ProfileqRT-PCR via
Total RNA contents were isolated from respective cells via TRIzol reagent (Invitrogen). The cDNAs were reverse-transcribed as per the manufacturer's directions via a reverse transcription kit (Invitrogen). The qPCR reactions were conducted using primers that were specific to mice and targeted the TNF-α, IL-10, IL-6, IL-1β, Arg-1, and β-actin genes (Table 1). mRNA expression was normalized with β-actin, which is regarded as the internal or standard control. The Bio-Rad Real-Time System was used to conduct PCR reactions via TB GreenTM Premix Ex TaqTM II (Tli RNaseH Plus).
| Genes | Sequence (5’-3’) | Length, nt | Size (bp) | Annealing Temperature, (°C) |
|---|---|---|---|---|
| TNF-α | For: AACTCCAGGCGGTGCCTATGRev: TCCAGCTGCTCCTCCACTTG | 2020 | 242 | 64 |
| IL-6 | For: AAGTCCGGAGAGGAGACTTCRev: TGGATGGTCTTGGTCCTTAG | 2020 | 487 | 58 |
| IL-10 | For ACTCTTCACCTGCTCCACTGRev: GCTATGCTGCCTGCTCTTAC | 2020 | 415 | 60 |
| Arg-1 | For: CCAGATGTACCAGGATTCTCRev: AGCAGGTAGCTGAAGGTCTC | 2020 | 191 | 55 |
| IL-1β | For: AGCTTCAGGCAGGCAGTATCRev: TCATCTCGGAGCCTGTAGTG | 2020 | 215 | 60 |
| β-actin | For: CACGAAACTACCTTCAACTCCRev: CATACTCCTGCTTGCTGATC | 2120 | 265 | 55 |
Detection of cytokinesELISA via
As per the manual's instructions (Dakewe, Beijing, China), the quantity of IL-6 and IL-10 in the collected supernatants was monitored using ELISA kits. The absorbance (OD) was detected at 450 nm via the NanoDrop™ 8000 Spectrophotometer (ND-8000-GL, Thermo Scientific™).
Flow Cytometry
Cells were grown in 6-well plates in appropriate media for 24 h. Next, the cells were labeled with anti-CD206 antibody (1:20, ARG22456↗, Arigobio, China) at 25°C for 30 min and then kept with FITC-labeled secondary antibody (ARG23840↗, 1:500, Arigobio) at 25°C for 15 min. The proportion of cells expressing CD206 was measured by FC.
Western Blot Analysis
The lysates of total or nuclear proteins were isolated from cultured cells and hucMSCs-EX. Proteins contents were quantified with a BCA kit (Thermo Fisher Scientific). Protein in aliquots of equal weight (40 μg) was loaded onto a 10% SDS-PAGE and subsequently transferred to nitrocellulose membranes. After 1 h of blocking in 5% skim milk at 25°C, the blots were kept at 4°C for 24 h with respective primary antibody dilutions and then labeled with secondary HRP-linked antibody at 37°C for 2 h. The bands of protein were detected via an HRP substrate (EMD Millipore). and examined using MD ImageQuantTM Software (G: Box; Syngene, Cambridge, UK). β-actin, as well as histone H3.1, were employed as reference controls for cell cytoplasmic and nuclear proteins. Following were the Rabbit monoclonal antibodies used for WB analysis: anti-human CD9 antibody (1:500: BS60359, Bioworld Technology, USA), anti-human CD63 (1:1000: ab134045, Abcam, Cambridge, UK), anti-human Alix 3 (1:1000: ab186728, Abcam), anti-Lamin A antibody (1:2000: ab108595, Abcam), anti-human β-Tubulin (1:2000: AP0064, Bioworld), anti-mouse CD206 (1:1000: ab64693, Abcam), anti-mouse NF-κB p65 (1:1000: #C48676↗, SAB, CA), anti-mouse NF-κB p-p65 (S536, 1:1000: ab76302, Abcam), anti-mouse p-STAT3 (Tyr539, 1:500, #13150, SAB), STAT3 (1:500, #53229, SAB), Rabbit polyclonal anti-mouse Histone H3.1 (1:500: BS90644(P68433↗), Bioworld) and anti-β-actin (1:2000: AP0060, Bioworld). The goat anti-Rabbit IgG(H+L)-HRP antibody (1:2000, Bioworld Technology Cat# BS13278, RRID: AB_2773728) was purchased from Bioworld.
Immunofluorescence Staining
Cells were cultured for 24 h on glass slides coated in 24-well plates. Further, they were co-incubated with complete RPMI-1640 medium, hucMSCs-CM, and hucMSCs-EX for 48 h. Cells were rinsed twice with PBS and fixed in 4% paraformaldehyde (PFA, AR-0211; DingGuo Biotechnology China) solution for 30 min at 4°C. Blocking (5% BSA) was performed and cells were kept with rabbit anti-mouse CD206 monoclonal antibody (1:500, ARG22456↗, Arigobio) at 4°C for 24 h and followed by FITC-linked anti-rabbit secondary antibodies (1:200, ARG23840↗, Arigobio) at 37°C for 2 h. Cells were stained with DAPI to detect cell nuclei. Fluorescence images of cells were obtained using ECLIPSE Ti-S, Nikon, Japan.
Cell Proliferation Assays
Metabolic or proliferative activity of RAW264.7 cells was detected via the MTT assay. Precisely, approximately 2 × 103 cells/well were grown in a 96-well plate and kept with 100 μL of complete medium (serve as the control group), hucMSCs-CM and hucMSCs-EX mixed in the presence or absence of LPS (1 μg/mL). The cells were subjected to incubation at 25°C for 4 h after adding 20 μL MTT to each well at the respective times of 24, 48, and 72 h. Finally, the media were discarded and absorbances were monitored at 450 nm via a microplate reader (RNE90002↗, USA).
Cell Migration Assays
In this assay, RAW264.7 cells (5 × 104 in 200 μL of incomplete medium) were allowed to grow in a 24-well plate (8.0-µm polycarbonate membrane) (Costar, CA, USA). They were seeded to the upper surface of the compartment while the lower surface was filled with only medium (600 µL). Further, hucMSCs-CM and 600 µL hucMSCs-EX were mixed, respectively. In each well, LPS (1 μg/mL) was added. The upper surface of the membrane was cleared of any residual cells after a 12-h incubation via a cotton swab. The migrated cells were fixed for 8 min with 4% PFA on the lower surface of the membrane. Crystal violet solution was used to stain the cells for 15 min. After washing with PBS (thrice) cells were dried, examined, and quantified under an inverted microscope (Olympus, Tokyo).
Statistical Analysis
Data was statistically evaluated via GraphPad 9.3 (Graph Pad Software) and SPSS 21.0 (IBM Corp.) software and were depicted as mean ± SEM derived from ≤ triplicate analyses. Group comparison was performed using Student’s t-test and One-way ANOVA with Tukey’s post hoc tests. A p-value ≤ 0.05 was regarded as a significant threshold.
Ethical Considerations
This study was performed on cell lines and on human umbilical cord tissue. Human umbilical cords used in this study are normally discarded as medical waste so no ethical concerns are involved in obtaining hucMSCs-EX. There were no humans were directly involved in this study. No work with human subjects was directly involved in our study.
RESULTS
Characterization of hucMSCs and hucMSCs-EX
Primary cultured hucMSCs adhered to the plastic surface after migrating from the human umbilical cord tissues. They have fibrous morphology and fingerprint-like growth characteristics under an inverted microscope (Fig. 1A1 and A2). In the third passage, after subcultures, a population of hucMSCs that was relatively homogeneous was observed (Fig. 1A3). Multidirectional in vitro differentiation (adipogenic and osteogenic) was displayed by hucMSCs. As shown in Fig 1B2, the cells comprised fat particles and were stained red; similarly, calcium deposits were stained red in the cells (Fig. 1B3). Exosomes were predominantly round lipid-coated microvesicles resembling tea saucers, as detected using TEM. The exosomes showed a range of sizes from 40 to 100 nm (Fig. 1C and D). The Western blot (WB) analysis revealed an upregulation of exosome proteins CD9, CD63, and Alix3 in the hucMSCs-EX (Fig. 1E). The extraction of hucMSCs-EX was successful.
Images of the hucMSCs' morphology under a light microscope. (1) Morphology of primary hucMSCs (100x);(2, 3) Morphology of hucMSCs at third passage (100x).Identification of differentiation potential of hucMSCs. (1) hucMSCs of the third passage serve as a control; (2, 3) Differentiation of hucMSCs was assessed using Alizarin Red and Oil Red O stains.Exosomes derived from hucMSCs (hucMSCs-EX) are depicted in TEM images. Scale bar 100 nm.Nanosight Particle Size Analyzer was used to detect the particle size distribution of hucMSCs-EX.Representative WB analysis for exosome proteins (CD63, CD9, and Alix3). Triplicate experiments were carried out. hucMSCs are abbreviated for human umbilical cord MSCs. Identification of hucMSCs and hucMSCs-EX. (A) (B) (C) (D) E, in vitro
, hucMSCs-EX Stimulated M2 Macrophage Polarization In vitro
Compared with RPMI-1640 medium, hucMSCs-CM or hucMSCs-EX significantly increased Arg-1 and IL-10, while markedly reducing TNF-α and IL-6 expression in LPS-induced cells (Fig. 2A). Further, IL-6 and IL-10 were identified in the culture supernatants of the macrophages via ELISA, as previously outlined. In line with the qRT-PCR findings, hucMSCs-EX or hucMSCs-CM substantially inhibited the secretion of IL-6 (Fig. 2Ba), an essential pro-inflammatory cytokine, while markedly increasing the release of IL-10 (Fig. 2Bb).
hucMSCs-EX increased M2 macrophage gene expression and decreased M1 gene expression in LPS-stimulated cells.In the experiment, RAW264.7 cells were treated with LPS (1μg/mL) for 4 h. They were incubated with a complete medium, hucMSCs-CM (1:1 in fresh complete medium), and 5μg/mL hucMSCs-EX for 48 h. The mRNA levels of(),(),(), and() were quantified using qRT-PCR.The expressions of() and() in the collected supernatant, as described above, were determinedELISA (*≤ 0.05, **≤ 0.01, ***≤ 0.001). (A), a b c d (B) a b TNF-α IL-6 IL-10 Arg-1 IL-6 IL-10 via p p p
hucMSCs-EX Enhanced CD206 Expression
The protein expression of CD206 (mannose receptor), a widely known marker for M2 macrophages was detected to identify whether hucMSCs-EX elicited the M2 phenotype [20], in cells via FC and WB analysis. The hucMSCs-EX or hucMSCs-CM substantially raised the quantity of CD206 expressing macrophages (Fig. 3A). In consensus with the findings from FC, immunofluorescence staining and WB analyses revealed substantially increased levels of CD206 in respective cells exposed with hucMSCs-CM and hucMSCs-EX, relative to the control group (Fig. 3B and C).
hucMSCs-EX enhanced CD206 expression.Flow cytometric analysis displayed the number of CD206-positive cells. Cells were co-incubated with different media for 48 h: RPMI-1640 medium as a control group, () hucMSCs-CM, and () hucMSCs-EX (5μg/mL). Cells were then treated with () CD206 primary and FITC-conjugated secondary antibodies (d) Flow cytometry also analyzed the number of CD206-positive cells, and triplicate experiments were carried out for final analysis.Isolated proteins from RAW264.7 cells stimulated with hucMSCs-EX were analyzed using WB with a particular antibody targeting CD206.RAW264.7 cells were untreated or maintained with hucMSCs-EX for 48 h. Immunofluorescent staining monitored the levels of CD206 in respective cells *≤ 0.05, **≤ 0.01 vs. RAW264.7 (Control). (A), a b c (B), (C), p p
hucMSCs-EX Stimulate RAW264.7 Cell Propagation and Migration
To identify whether hucMSCs-EX or hucMSCs-CM can promote macrophage proliferation and migration, MTT and cell counting assays were carried out. As depicted in Fig. (4A), the OD values of hucMSCs-EX and hucMSCs-CM groups were higher than those in the control and LPS-induced RAW264.7 groups 48 h after treatment, respectively. In line with the findings of the MTT, the cell counting assay demonstrated that hucMSCs-EX or hucMSCs-CM markedly enhanced proliferation in LPS-induced cells 48 h after treatment (Fig. 4B). The migratory capability of respective cells after treatment with hucMSCs-EX was then evaluated. The data depicted in Fig (4C and D) suggest that 12 h after treatment, the quantity of migrated cells was higher in the hucMSCs-EX or hucMSCs-CM group in contrast to the control group.
hucMSCs-EX enhanced LPS-stimulated RAW264.7 cell propagation and migration.hucMSCs-EX enhanced the propagation of LPS-stimulated cells. Cells were cultured with or without LPS (1μg/mL) in complete medium, hucMSCs-CM and hucMSCs-EX for 24, 48, and 72 h, respectively.Quantification of cell proliferation by cell counting assayshucMSCs-EX promotes the migration of LPS-stimulated cells. Cells were inoculated on the upper surface of the chamber, and the bottom chambers were enriched with RPMI-1640 medium () or with LPS (), hucMSCs-CM () or with LPS (), and hucMSCs-EX () or with LPS (), respectively. Representative images depict the invasion of cells treated with hucMSCs-EX.the numbers of the migrated cells were counted after 12 h. (*≤ 0.05, **≤ 0.01. RAW264.7). (A), (B), (C), a d b e c f (D), p p vs
hucMSCs-EX Induces M2 Macrophage Phenotype by Suppressing the LPS-induced Stimulation of NF-κB p65 and STAT3 Pathways
Western blotting determined the concentrations of the cytoplasmic protein NF-κB p-p65 and the nuclear protein NF-κB P65 in respective cells. As illustrated in Fig. (5A and B), the distribution of NF-κB p65 proteins in uninduced RAW 264.7 cells was predominantly found in the cytoplasmic fraction. An increase in phosphorylated NF-κB p65 (NF-κB p-p65) and NF-κB p65 was seen after 1 h of LPS stimulation (Fig. 5A). However, this effect was antagonized by hucMSCs-EX (Fig. 5A and C). The qRT-PCR findings indicated that the NF-κB p65 activation induced by LPS specifically targeted IL-1β and TNF-α (Fig. 5D and E). The expressions of TNF-α (Fig. 5D) and IL-1β (Fig. 5E) were inhibited by hucMSCs-EX. The results demonstrated that hucMSCs-EX inhibited the LPS-promoted phosphorylation of NF-κB p65, NF-κB p65, and the downstream secretions of TNF-α and IL-1β. Considering the significance of the NF-κB and STAT3 pathways in M2 macrophage polarization [21], a possible connection between the role of MSCs-EX and STAT3 signaling was monitored. RAW264.7 cells were exposed to hucMSCs-EX at various time intervals. The WB analysis revealed a significant upregulation of p-STAT3 expression 1 h after treatment, which persisted in an activated state for the next 4 h (Fig. 6A). To confirm the function of STAT3 stimulation in the polarization induced by hucMSCs-EX, cells were treated with hucMSCs-EX with or without the presence of STAT3 inhibitor, S3I-201, under both normal and LPS-induced environments. The findings indicated that the upregulation of Arg-1 and the activation of p-STAT3 by hucMSCs-EX were both inhibited by S3I-201 (Fig. 6B and C). Further, S3I-201 inhibited the synthesis of CD206 protein in cells induced by hucMSCs-EX (Fig. 6D). Collectively, these results demonstrate that MSCs-EX stimulates the STAT3 pathway in respective cells to induce M2 polarization.
hucMSCs-EX inhibits LPS-induced NF-κB P65 stimulation.Cells were treated LPS (1μg/mL) for 2 h and then incubated with hucMSCs-EX for 48 h. The WB analysis determined the level of NF-κB P65 (nucleus) and NF-κB p-P65 (cytoplasm) in RAW264.7 cells. Both β-actin and H3.1 were employed as reference controls for cell cytoplasmic and nuclear proteins, hucMSCs-EX inhibited the phosphorylation of NF-κB p65 (NF-κB p-p65) in respective cells stimulated by LPS.Cells were treated with LPS (1μg/mL) for 4 h, then maintained in hucMSCs-EX for 48 h. The mRNA expressions ofandwere assessedRT-PCR. (*≤ 0.05, **≤ 0.01, #≥ 0.05;). (A), (B), (C) (D), (E) IL-1β TNF-α via p p p
hucMSCs-EX induces M2 polarizationSTAT3 pathway stimulation.Cells were maintained for 1, 2, and 4 h in hucMSCs-EX or control medium. The p-STAT3 and STAT3 concentrations were measuredWB analysis. Protein levels of STAT3 and p-STAT3 were markedly increased by hucMSCs-EX (**≤ 0.01, #≥ 0.05).Cells were incubated with hucMSCs-EX or a control medium for 24 h with or without S3I-201 (100 μmol/L). The STAT3 phosphorylation of cells was then confirmed by WB analysis after 2 h of incubation with LPS (1 μg/mL) (*≤ 0.05, **≤ 0.01).The content of RNA was isolated from the RAW264.7 cells (B), and themRNA was amplified by qRT-PCR (*≤ 0.05).Cells were grown in hucMSCs-EX or complete medium for 24 h, with or without S3I-201 (100 μmol/L). The quantification of CD206 expression in respective cells was carried outWB analysis (**≤ 0.01). via via p p p p Arg-1 p via p (A), (B), (C), (D),
DISCUSSION
Macrophages can be classified into M1 or M2 phenotypes based on their environment. They have significant functions in initiating and advancing inflammatory responses [22]. M1 macrophages are identified by the high expression of IL-6, TNF-α, IL-8, and IL-12, whereas M2 macrophages are recognized by the high levels of Arg-1, IL-10, and CD206. Studies have indicated that hucMSCs-CM have potent chemoattractive effects on monocytes in vitro and promote macrophage proliferation during wound healing mechanism [14, 23]. Dayan et al. [24] revealed that acute myocardial infarction mice infused with MSCs had a substantial increase in the macrophage numbers in the heart and circulation, which could be linked with improved cardiac function. The findings of this study suggested that hucMSCs-EX induced migration and proliferation of RAW264.7 cells in vitro, despite LPS stimulation and confirm previous reports that suggested that exosomes derived from MSCs may affect inflammatory effects by recruiting macrophages against inflammatory stimuli. This study evaluated markers associated with the M1 and M2 activation stages and indicated that hucMSCs-EX can prevent the LPS-induced polarization of respective cells into M1-type macrophages. Moreover, hucMSCs-EX also stimulated the differentiation of RAW264.7 cells into the M2 phenotype. These results indicate that exosomes derived from MSCs could induce a phenotype switch of the recruited macrophages in the inflammatory micro-environment to favor relief of inflammation. However, more studies are required to understand the precise mechanism through which hucMSCs-EX affects the polarization of macrophages in the inflammatory response.
Recent research has demonstrated that NF-κB regulates macrophage polarization, a crucial factor in determining whether inflammatory events initiate or terminate [25]. Moreover, they have also found that the p65 (RelA) is a vital member of the NF-κB family that contributes to the M1 macrophage polarization and the secretion of inflammatory mediators [7, 25, 26]. The current study revealed that NF-κB p65 nuclear translocation was impeded by MSCs-EX against LPS induction which could help to describe the downregulation of M1 macrophage-associated genes after treatment with hucMSCs-EX. According to Qian et al. [27], the activation of STAT3 is linked to the macrophage M2 phenotype and the release of anti-inflammatory factors. Moreover, STAT3 has a crucial function in preserving the equilibrium between pro-inflammatory and anti-inflammatory factors in immune-competent cells, thereby maintaining homeostasis. The impact of MSCs-EX on STAT3 in respective cells was examined. It was observed that the levels of phosphorylated STAT3, Arg-1, and CD206 in cells were markedly raised by hucMSCs-EX. It was also found that the STAT3 inhibitor S3I-201 effectively counteracted the phosphorylation of STAT3 and the expression of Arg-1 and CD206 induced by hucMSCS-EX in cells. Based on these findings, phosphorylated STAT3 was implicated in the polarization of macrophage M2 induced by MSCs-EX, whereas LPS-induced macrophage M1 polarization engaged NF-κB p65, which could potentially be inhibited by MSCs-EX. Overall, the induction of the M2 phenotype in macrophages was promoted by MSCs-EX via the stimulation of the STAT3 and the suppression of NF-κB pathways.
This study suggests that hucMSCs-EX induced the activation of STAT3 pathways and inhibited the stimulation of the NF-κB p65 pathway, thereby promoting macrophages to adopt an M2 phenotype. This led to the formation of an anti-inflammatory microenvironment. Moreover, the anti-inflammatory mechanism was identified as one by which hucMSCs-EX inhibits infection and tissue damage. Tissue repair could potentially be stimulated through the efficient regulation of inflammation, a universal response against injury. The potential therapeutic application of hucMSCs-EX stems from their ability to promote tissue repair via modulation of inflammatory-associated immune cells.
CONCLUSION
In conclusion, this study presented an alternate approach for controlling the inflammatory response using MSC-derived exosomes as mediators, which may direct macrophages toward the M2 phenotype. Therefore, our study provides a novel perspective for improving MSC functions in clinical applications by regulating inflammatory responses.
ACKNOWLEDGEMENTS
Declared none.
LIST OF ABBREVIATIONS
AUTHORS’ CONTRIBUTIONS
It is hereby acknowledged that all authors have accepted responsibility for the manuscript's content and consented to its submission. They have meticulously reviewed all results and unanimously approved the final version of the manuscript.
ETHICS APPROVAL AND CONSENT TO PARTICIPATE
Not applicable.
HUMAN AND ANIMAL RIGHTS
Not applicable.
CONSENT FOR PUBLICATION
Not applicable.
AVAILABILITY OF DATA AND MATERIALS
We declare that all data and supporting information is provided in this article.
FUNDING
This work was supported by grants from the Anhui Provincial Natural Science Foundation (Grant no. 1908085MH258), Anhui Provincial Health Research Project (Grant no. AHWJ2023A10057), program for Graduate Research of Bengbu Medical College (Grant no. Byycxz21004; Byycxz22036) and Science and Technology Innovation Guidance Project of Bengbu (Grant no. 20220112).
CONFLICT OF INTEREST
The authors declare no conflict of interest, financial or otherwise.
REFERENCES
Associated Data
Data Availability Statement
We declare that all data and supporting information is provided in this article.