What this is
- This research investigates the role of human antigen R (HuR) in lung fibroblast differentiation and metabolic reprogramming under hypoxic conditions.
- Pulmonary fibrosis, particularly idiopathic pulmonary fibrosis (IPF), is characterized by excessive fibroblast differentiation into , driven by transforming growth factor beta (TGF-β).
- The study explores how HuR influences these processes in human lung fibroblasts (HLFs) when exposed to TGF-β and hypoxia.
Essence
- HuR regulates differentiation in response to TGF-β but does not control under hypoxic conditions. Hypoxia reduces TGF-β-induced differentiation and lactate production.
Key takeaways
- Hypoxia combined with TGF-β increases mRNA levels of differentiation and genes but reduces protein levels of α-SMA and collagen I. This indicates a disconnect between mRNA expression and protein production.
- Knockdown of HuR decreases features of fibroblast differentiation, including α-SMA and collagen I, confirming HuR's role in promoting differentiation. However, HuR knockdown does not affect lactate secretion.
- The findings suggest that while HuR is crucial for differentiation, it does not influence the metabolic shift towards in response to hypoxia.
Caveats
- The study does not fully elucidate the mechanisms by which hypoxia reduces fibroblast differentiation and lactate production. Further research is necessary to clarify these pathways.
- The results may not be generalizable beyond the specific fibroblast populations studied, as variations exist in fibroblast function across different tissues and conditions.
Definitions
- myofibroblast: A differentiated fibroblast that expresses α-smooth muscle actin (α-SMA) and produces extracellular matrix proteins, contributing to tissue remodeling.
- glycolysis: A metabolic pathway that converts glucose into pyruvate, producing energy in the form of ATP, often occurring under low oxygen conditions.
AI simplified
Background
Interstitial lung diseases (ILDs) are an array of lung disorders that involve varying degrees of inflammation and fibrosis of the lung parenchyma [1, 2]. The most fatal form of ILD is idiopathic pulmonary fibrosis (IPF), a chronic, progressive disease distinguished by abnormal accumulation of fibrotic tissue [2, 3]. Although the cause of IPF is not known, various environmental, microbial, and genetic factors are proposed to play important roles in IPF pathobiology. The current paradigm of pathogenesis for IPF is that recurrent damage to the alveolar epithelium promotes an abnormal wound-healing response that results in fibrosis rather than repair [4]. It is thought that damage to the alveolar epithelium drives the accumulation of myofibroblasts, which are α-smooth muscle actin (α-SMA)-expressing cells that produces copious amounts of extracellular matrix (ECM) proteins such as collagens (COL) and fibronectin (FN), which contribute to dysfunctional tissue remodeling [5].
The differentiation of fibroblasts into ECM-producing myofibroblasts occurs under the direction of cytokines, particularly transforming growth factor-β (TGF-β). TGF-β is produced as a latent protein that requires activation by factors such as mechanical stretch and changes in pH [6]. This change in extracellular pH can be due to a switch from oxidative phosphorylation to aerobic glycolysis, a state in which predominant uptake/use of glucose for energy persists despite the presence of adequate oxygen for mitochondrial respiration [7, 8]. The conversion of glucose to lactate contributes to an acidic extracellular environment as the lactate is excreted from the cell [9]. There is emerging evidence that the development of aerobic glycolysis in IPF occurs when the acidic microenvironment promotes myofibroblast differentiation, in part, through pH-dependent activation of latent TGF-β [10] 11. Furthermore, excessive accumulation of myofibroblasts and ECM within the alveolar space creates hypoxic conditions.
In both instances, glycolysis can be driven by hypoxia inducible factor-1α (HIF-1α), an oxygen-sensitive transcription factor. HIF-1α increases some of the key glycolytic genes including glycolytic enzymes hexokinase-2 (HK2/HKII) and lactate dehydrogenase A (LHDA/ LDH5) [12–14]; LDHA converts pyruvate to lactate during glycolysis. Mechanistically, HIF-1 is classically known to be activated under hypoxic conditions where it is protected from proteolytic degradation. HIF-1α can also be regulated by human antigen R (HuR) [15–17], a member of the Hu/embryonic lethal, abnormal vision (ELAV) family of RNA-binding proteins [18]. HuR is best-known to stabilize target mRNA by binding to mRNA with an adenylate-and uridylate- rich element (ARE) in the 3’ untranslated region (3’UTR) [19]. Binding of HuR to the 3’UTR of target mRNA facilitates nuclear export and prevents degradation of the mRNA, which increases cellular protein levels by allowing the message to be efficiently translated. We have recently shown that HuR controls myofibroblast differentiation and ECM production in response to TGF-β in primary human lung fibroblasts (HLFs) [20]. We now question whether under hypoxic conditions, HuR plays a role in controlling metabolic reprogramming in addition to TGF-β-induced myofibroblast differentiation. Herein, we describe the unexpected findings that hypoxia reduces TGF-β-induced myofibroblast differentiation and glycolytic reprogramming, but that the switch to glycolysis occurred independently of HuR. This study is the first to investigate the role of HuR in myofibroblast differentiation and metabolic reprogramming in response to hypoxia, which could help provide the basis for new targeted therapy in fibrotic disease such as IPF.
Methods
Derivation and culture of HLFs
Primary HLFs were derived from lung tissue obtained through lung resection surgery in subjects undergoing the procedure at McMaster University as previously described [21]. This study was conducted on HLFs from three different subjects with no smoking history and or other known risk factors (e.g., radiation therapy) for lung fibrosis. Cells were cultured in MEM (Thermo Fisher Scientific, USA) containing 10% fetal bovine serum (FBS; Hyclone Laboratories, Logan, UT) supplemented with gentamycin (WISENT Inc, Canada) and Antibiotics-Antimycotics (WISENT Inc, Canada). HLFs were used with a cell passage number between 6 and 9.
Cell treatments
To mimic normoxia, HLFs were incubated in humidified chambers at 37 °C and 21% O2 /5% CO2. Under hypoxic conditions, HLFs were incubated at 37 °C and 1% O2 /5% CO2 using the Xvivo System Model X3 hypoxia incubator (BioSpherix Ltd, USA). Under both normoxia and hypoxia conditions, HLFs were either left untreated or treated with human recombinant TGF-β1 (R&D Systems, USA). Incubation times are indicted for each experimental outcome.
Immunofluorescence (IF)
HLFs were treated under normoxia, hypoxia, TGF-β or hypoxia plus TGF-β1 for 4 h, followed by fixation with paraformaldehyde for 15 min and permeabilization for 30 min in PBS containing 0.5% Triton. Once HLFs were incubated with blocking buffer (Dako, USA) for 1 h at room temperature, cells were incubated in a 1:300 dilution of anti-HuR antibody (Santa Cruz, USA) in antibody diluent (Dako, USA) or with antibody diluent only for 2 h at room temperature. After PBS washes, cells were incubated in a 1:1000 dilution of secondary antibody Alexa fluor 555 (Invitrogen, USA). Then, HLFs were washed with PBS and nuclei were stained in a 1:1000 dilution of Hoechst 33342 (Thermo Fisher, USA). Images were acquired through the Zeiss LSM 780 confocal microscope (Zeiss, Germany). ICY software was used for bioimage analysis to quantify HuR cytoplasmic translocation.
Quantitative RT-PCR (qPCR)
| Gene | Forward Primer Sequence | Reverse Primer Sequence |
|---|---|---|
| ELAVL1 | AACGCCTCCTCCGGCTGGTGC | GCGGTAGCCGTTCAGGCTGGC |
| COL1A1 | CAGACTGGCAACCTCAAGAA | CAGTGACGCTGTAGGTGAAG |
| ACTA2 | GACCGAATGCAGAAGGAGAT | CACCGATCCAGACAGAGTATTT |
| FN1 | CTGAGACCACCATCACCATTAG | GATGGTTCTCTGGATTGGAGTC |
| S9 | CAGCTTCATCTTGCCCTCA | CTGCTGACGCTTGATGAGAA |
| LDHA | GGAGATTCCAGTGTGCCTGT | CGTAAAGACCCTCTCAACCACC |
| HKII | GGGCGGATGTGTATCAAT | GTGAGCCCATGTCAATCT |
Western blot
Total cellular protein was extracted using RIPA lysis buffer (Thermo Fisher Scientific, USA) in conjunction with Protease Inhibitor Cocktail (Roche, USA). Protein lysates were electrophoresed on 10% SDS-PAGE gels and transferred onto Immuno-blot PVDF membranes (Bio-Rad Laboratories, USA). After transfer, the membrane was blocked with a blocking solution of 5% w/v non-fat dry milk in 1 × PBS/0.1% Tween-20 for one hour at room temperature. Antibodies were applied to membranes for 1 h or overnight. The following antibodies used were: anti-HuR (1:2000; Santa Cruz, USA), anti-α-SMA (1:5000; Sigma-Aldrich, USA), anti-Col1A1 (1:200; Santa Cruz, USA), anti-HIF-1α (1:1000; Abcam, USA), anti-FN (1:200; Santa Cruz, USA), anti-HKII (1:1000; Cell Signaling), anti-LDHA (1:1000; Cell Signaling) and anti-Tubulin (1:50,000; Sigma-Aldrich, USA). Secondary antibodies were anti-rabbit IgG, horseradish peroxidase (HRP) linked (1:10,000; Cell Signaling Technologies, USA) and HRP conjugated anti-mouse IgG (1:10,000; Cell Signaling Technologies, USA). Membrane visualization was performed by using Clarity western enhanced chemiluminescence (ECL) substrate (Bio-Rad Laboratories, Canada) or SuperSignal West Femto Maximum Sensitivity Substrate (Thermo Scientific, USA). Detection of protein bands was done by the ChemiDoc MP Imaging System (Bio-Rad Laboratories). Densitometric analysis was done using Image Lab Software Version 5 (Bio-Rad Laboratories) and protein expression was normalized to tubulin and presented as fold change compared to normoxia.
Cytoplasmic and nuclear protein fractionation
Cytoplasmic and nuclear protein fractions were obtained using a nuclear extraction kit as per manufacturer instructions (Active Motif, Carlsbad, CA). Protein concentrations were determined by the BCA protein assay kit. Western blot and antibodies used were described above. Lamin A/C (1:1000; Cell Signaling Technologies, CA) was used as a marker for the nuclear fraction and β-Tubulin (1:50,000; Sigma, CA) was used as a marker for the cytoplasmic fraction.
Proton nuclear magnetic resonance (H NMR) 1
Cell supernatants were collected and supplemented with 10% D2O for shift lock and 1 mM total soluble protein (TSP) standard (Sigma Aldrich). The 1H spectra were obtained using a 500-MHz Bruker machine using a pre-saturation method following 128 scans. Spectra analysis was performed using ACD Labs software (Advanced Chemistry Development UK Ltd, UK) and integrals for peaks at 5.2 ppm (glucose) and 1.3 ppm (lactate) were quantified in relation to the standard internal TSP peak at 0.0 ppm.
RNA immunoprecipitation-qPCR (RIP-qPCR)
HLFs were grown to approximately 70–80% confluence and cultured with serum-free MEM for 18 h before the treatment after which cells were rinsed with PBS and collected by cell scraper in PBS. Cells were centrifuged at 1500 rpm, 4 °C for 5 min, then the PBS discarded. Cell pellets were harvested in the lysis buffer as previously described [20], incubated for 15 min on ice and then centrifuged at 10,000 rpm, 4 °C for 15 min. The cell extracts were transferred into a new tube and the protein concentration was measured. Thirty-five μl of protein G Sepharose™ 4 fast glow beads (GE Healthcare) were pre-coated with 2 μg of IgG (Cell Signaling Technologies, CA) or 2 μg of anti-HuR (Santa Cruz Biotechnology) antibodies overnight on a rotator at 4 °C. Beads were washed, incubated with cell extracts for 2 h at 4 °C and washed again to remove unbound material. RNA was then extracted, reverse transcribed and analyzed by qRT-PCR as described above. RNA expression was normalized to S9 mRNA bound in a non-specific manner to IgG [22, 23].
HuR-siRNA knockdown
HLFs were seeded at 10 × 104 cells/cm2 and one day later were transfected with 60 nM of small-interfering RNA (siRNA) targeting HuR (Santa Cruz, USA) or non-targeting control siRNA (Santa Cruz) using Lipofectamine RNAiMAX Transfection Reagent (Thermo Fisher Scientific, USA). After one hour, 10% MEM medium was added onto the cells. Twenty-four hours later, fibroblasts were treated with serum-free MEM medium for 18 h, followed by treatment under normoxia, hypoxia, TGF-β1 or hypoxia plus TGF-β1 for 72 h.
Statistical analysis
Statistical analysis was performed using one or two-way analysis of variance (ANOVA) with Bonferonni's or Tukey’s multiple comparisons using GraphPad Prism 6 (v.602; GraphPad Software Inc, USA). Statistical significance was considered in all cases which had a p value < 0.05.
Results
Hypoxia attenuates TGFβ1-induced metabolic shift towards glycolysis
TGF-β1 dose-dependently increases mRNA expression of genes involved in metabolic reprogramming. Fold change was calculated utilizing the ΔΔCt method normalized tofor(),() and(). There was a significant induction inandonly at the highest concentration of TGF-β used (10 ng/ml). Each sample is normalized to the untreated control for that same time-point (*p value ˂ 0.05; ****p ˂ 0.0001). Results are expressed as the mean ± SEM, n = 6 independent experiments.There was an increase in protein levels of HIF-1α in response to hypoxia and CoClfor 6 h. Representative western blot is shown GAPDH LDHA HKII HIF-1α HKII HIF-1α a b c d 2
Alterations in components of the glycolytic pathway.There was a significant increase inmRNA levels following treatment with hypoxia with TGF-β1.There was a modest increase inmRNA after treatment with hypoxia and TGF-β1. Values are represented as the mean ± SEM (n = 3–4 independent experiments utilizing cells from 3 separate subjects). Means are expressed as fold change from the control (24 h- normoxia; *p < 0.05 compared to control).There was a significant increase in LDHA protein in response to TGF-β together with hypoxia compared to normoxia.HKII protein did not significantly changes with exposures a b c d LDHA HKII
Hypoxia decreases lactate production in conjunction with TGF-β1.Representative spectra from the 72 h time-point for normoxia, hypoxia, TGFβ1- and hypoxia with TGF-β. Lactate (1.3 PPM) and glucose (5.2 PPM) peaks were integrated in comparison to benzoic acid to determine the concentration (mmol/l), labelled in green, of both molecules in every sample byH NMR spectroscopy.Quantification of the fold change in lactate and glucose concentrations at 24 h.Quantification of fold change in lactate and glucose concentrations at 48 h.Quantification of fold change in lactate and glucose concentrations at 72 h. Values are represented as the mean ± SEM (n = 3 independent experiments using cells from 3 separate subjects); *p < 0.05, ** p < 0.01 and ***p < 0.001 a b c d 1
TGF-β1-induced fibroblast differentiation to myofibroblasts is reduced in response to hypoxia
Increased mRNA of,andin response to TGF-β1 and hypoxia with TGF-β1.mRNA signficantly increased by TGF-β1 at 48 h and by hypoxia with TGF-β1 at 24- and 48 h. The effect of TGF-β1 combined with hypoxia is significantly greater than TGF-β1 alone at 24- but not 48 h.The expression ofmRNA do not significantly change, although an increasing trend was observed in response to TGF-β1 alone and when combined with hypoxia.TGF-β1 increasedmRNA levels significantly at 48 h compared to normoxia and hypoxia. Values are represented as the mean ± SEM (n = 4 independent experiments utilizing cells from 3 separate subjects); *p < 0.05, **p < 0.01 and ***p < 0.001 ACTA2 COL1A1 FN1 ACTA2 COL1A1 FN a b c
TGF-β1-induced increase α-SMA and Collagen 1 protein is attenuated by co-exposure to hypoxia. Upregulation of α-SMAas well as collagen 1occurred in a time dependant manner in response to TGF-β1. This increase is attenuated following inclusion of hypoxia. There is no significant change in fibronectinprotein levels in response to hypoxia, TGF-β1 or hypoxia with TGF-β1. Values are represented as the mean ± SEM (n = 3–4 independent experiments using cells from 3 separate subjects); **p < 0.01; ***p < 0.001 and ****p < 0.0001 a b c
HuR translocation to the cytoplasm is increased by hypoxia
HuR expression and localization in response to hypoxia and TGF-β1.mRNA levels andprotein levels of HuR in HLFs were assessed 24–72 h following treatment with hypoxia, TGF-β1 and hypoxia with TGF-β1. Values are represented as the mean ± SEM (n = 4–6 independent experiments from 3 separate subjects).HuR localization using immunofluorescence at 20 × magnification (left panels) shows cytoplasmic translocation in HLFs treated with hypoxia, TGF-β1 and hypoxia with TGF-β1. White arrowheads designate blue nuclear staining (Hoescht) while white arrows indicate green cytoplasmic staining. Note the 63 × magnification images (right panels) showing representative cells and associated HuR localization. ActD was used as a positive control for HuR translocation to the cytoplasm. Images were pseudo-colored green for visualization purposes.HuR quantification of IF. Values are represented as the mean ± SEM (n = 3–4 independent experiments from 3 separate subjects; **p˂0.01; ***p < 0.001, and ****p < 0.0001.There was a noticeable increase in cytoplasmic levels of HuR with hypoxia with and without TGF-β. Representative western blot is shown a b c d e
HuR is required for fibroblast differentiation and ECM production
HuR knock-down attenuates TGF-β1-induced increase of α-SMA and Collagen I in HLFs.HuR siRNA significantly decreased HuR protein levels. TGF-β1-induced increase in protein levels of α-SMAand collagen Iwere downregulated significantly following HuR knock-down.There was a trend towards a decrease in FN protein level following HuR siRNA.HIF-1α was not altered by exposure to hypoxia with or without TGF-β1 at this timepoint in siCtrl cells. There was more HIF-1α in siHuR cells except in response to hypoxia. Values are represented as the mean ± SEM (n = 2–4 independent experiments using cells from 3 separate subjects); *p < 0.05, **p < 0.01, ***p < 0.001 and ****p < 0.0001 a b c d e
Hypoxia does not affect HuR binding to target mRNA
Hypoxia does not affect binding of HuR to select mRNA.Representative western blot of HuR immunoprecipitation (IP). Input is whole cell lysate. IgG is the IP with the control antibody and HuR refers to IP with the anti-HuR antibody. Note that the enrichment of(),(),() and FNis unaffected by exposure to hypoxia. Values are represented as the mean ± SEM (n = 4 independent experiments) a b c d (e) β-actin ACTA2 COL1A1
HuR does not play a significant role in a TGF-β1-induced metabolic shift
Lactate production does not change in response to HuR knock-down in HLFs. Sample spectra from HLFs transfected with siCtrland siHuRthat were treated with TGF-β1. Note the similar lactate and glucose peaks at 5.2 ppm and 1.3 ppm respectivelyQuantification of lactate concentration relative to glucose between siCtrl- and siHuR-transfected HLFs. Values are represented as the mean ± SEM (n = 3 independent experiments using cells from 3 separate subjects) a b c
HuR knockdown does not affect select proteins of the glycolytic pathway.HuR knockdown verification.There is no effect of HuR knockdown on HKII protein levels. (). HuR knockdown does not affect LDHA protein levels. Results are expressed as the mean ± SEM (n = 2 independent experiments) a b c
Discussion
IPF is a devastating and progressive disease that typically leads to respiratory failure, with a median survival of 3–5 years from diagnosis [2]. The exact cause of IPF remains unknown and the underlying mechanisms behind disease pathogenesis are poorly understood [30]. One of the main features of IPF is fibroblast-to-myofibroblast differentiation characterized by the expression of a-SMA and increased ECM production. An emerging feature of IPF is an increase in aerobic glycolysis and lactate production, resulting in pH-dependent activation of TGF-β1 and myofibroblast differentiation [10, 31, 32]. In this study, we focused on a novel link between myofibroblast differentiation, glycolysis and HuR. Current literature reveals that HuR regulates the stability and/or translation of target mRNA that encode proteins involved in pathogenic mechanisms that drive fibrotic disease. We recently reported that silencing HuR attenuates lung fibroblasts differentiation and collagen production [20]. We now sought to evaluate whether HuR regulates proteins of fibrotic and glycolytic pathways in lung fibroblasts upon treatment with TGF-β1 and hypoxia.
One of the more intriguing findings from this work was the combined effect of hypoxia and TGF-β1 on markers of myofibroblast differentiation and metabolic reprogramming. In this study, we hypothesized that HuR would mediate both fibroblast differentiation and metabolic reprogramming in response to hypoxia and TGF-β1 by stabilizing mRNAs of ECM and as well as those recognized as glycolysis markers. Our rationale was the fact that hypoxia-induced signaling underlies the pathogenesis of various life-threating lung diseases [33, 34]. In lung cancer, hypoxia is closely related to fundamental changes in tumor cells, resulting in resistance to cell death, increased angiogenesis and reprogramming energy metabolism including overexpression of the metabolic enzymes HKII and LDH, the net result of which increases glucose uptake and the switch to aerobic glycolysis [35]. With this rationale, the first step was to understand whether hypoxia affected differentiation and metabolic regulation in HLFs. We observed that hypoxia- when combined with TGF-β1- increased ACTA2 mRNA compared to TGF-β1 alone. This effect was time-dependent, as the induction of ACTA2 mRNA was seen only at 24 h; by 48 h post-treatment the effect of hypoxia in conjunction with TGFβ1 was not different from hypoxia alone. At the protein level, there was significantly less α-SMA and collagen expression from hypoxia together with TGF-β1. These data show that while hypoxia initially increases the transcriptional levels of ACTA2, there is reduced protein expression of α-SMA and collagens as well as lower lactate secretion. This was not due to changes ACTA2 mRNA binding to HuR as evaluated by RIP-qPCR analysis. Alterations in translation control occur in the context of IPF [36] and one cellular pathway implicated in cellular protein synthesis is the PI3K/Akt/mTORC1 signal transduction pathway [37]; this pathway is also involved in metabolism [38]. Recent evidence points to an indirect role for HuR in regulating components of this pathway in hypoxic cells [39]. Although not evaluated in this study, it could be that HuR fine-tunes translation control via the PI3K/Akt/mTORC1, and thus account for the discrepancy between mRNA and protein expression caused by combined exposure to hypoxia and TGF-β. Based on our observation that there is less HuR translocation to the cytoplasm in response to hypoxia and TGF-β, this suggests that sequestration of HuR to the nucleus may contribute to the lower levels of α-SMA and collagen proteins that is observed with the co-treatment.
Concurrent with this, we also evaluated whether hypoxia would regulate metabolic reprograming. Upon exposure to only 1% O2 (thereby mimicking cellular hypoxic conditions), there was minimal induction of LDHA and HKII mRNA nor was there an increase in lactate production. This relative lack of induction was surprising, as we had hypothesized that extracellular lactate would increase in response to hypoxia alone. Moreover, previous work has shown that HIF-1α leads to increased LDH and myofibroblast differentiation [10]. In contrast, we observed that exposure to hypoxia reduced TGFβ1-induced lactate production and myofibroblast differentiation. Although previous reports show that hypoxia increases markers of myofibroblast differentiation and glycolysis [32, 40, 41], our results do not support that hypoxia is a factor that contributes to myofibroblast differentiation in the lungs. It should be noted that we did not evaluate other important metabolic proteins (e.g., PDH, PFK, GLUTs etc.) involved in metabolic reprogramming that may be altered in response to hypoxia. Discrepancies between our results and previous reports could be due to differences in experimental protocols (e.g., length of exposures) and cells involved (e.g., IPF-derived cells versus non-diseases cells used in this study; e.g., MRC-5 cells (a fetal fibroblast cell line) [31] and adventitial fibroblasts [41]. This is an important difference, as there is remarkable heterogeneity of fibroblast function between and within organs, including the lungs [42–44]. Moreover, studies showing fibroblast differentiation in response to hypoxia and TGF-β reported changes in mRNA levels (and not protein) [40], the results of which are in line with our own (e.g., hypoxia plus TGF-β increasing ACTA mRNA). Other studies relied on immunostaining to evaluate HIF-1α expression in IPF tissue and the bleomycin model [45], which does not show causation. However, based on our data, we conclude that hypoxia may actually slow down the effects of TGF-β1 (e.g., differentiation and metabolic reprogramming) by relegating HuR back to the nucleus.
The mechanism through which hypoxia reduces fibroblast differentiation, ECM levels and lactate production induced by TGF-β1 is not known, but there are several possibilities. First, this response may involve the RhoA GTPase signaling network. RhoA regulates the serum response factor (SRF) and myocardin related transcription factor (MRTF) signaling pathway, that is important for fibroblast-to-myofibroblast differentiation [46, 47]. Recent literature has demonstrated that TGF-β1 stimulates RhoA, allowing it to activate MRTF/SRF complex. Once the MRTF/SRF complex is activated, it induces the transcription of target genes, including α-SMA and collagen [48–50]. Interestingly, RhoA is inhibited by ARHGAP29, which is increased following hypoxia exposure [51, 52]. ARHGAP29 belongs to a class of regulatory proteins which leads to RhoA inhibition [52]. Furthermore, hypoxia induces the transcriptional up-regulation of adenyl cyclases that inhibit RhoA activity [53]. Another possibility- and the focus of this body of work- is understanding whether hypoxia controls the differentiation of lung fibroblasts via HuR. Experimental data has shown that HuR stabilizes mRNA primarily containing AREs by protecting mRNA from degradation machinery [54]. It should be noted that HuR also has the ability to decrease mRNA stability and/or translation in response to various stimuli [55–57] with HuR translocation to the cytoplasm leading to functional changes [58]. Our data show the localization of HuR in the cytoplasm is increased in response to both hypoxia and TGF-β1 alone. This agrees with a previous study whereby hypoxia increased cytoplasmic HuR [59]. HuR translocation to the cytoplasm suggests that it could be controlling the expression of ECM markers and lactate secretion induced by TGF-β1. Indeed, knock-down HuR in HLFs significantly attenuates TGF-β1 induction of α-SMA and collagen I protein, reenforcing the notion that HuR is a master regulator crucial for driving myofibroblast differentiation. Interestingly, knockdown of HuR increased HIF-1α protein except in response to hypoxia. suggesting a dynamic interplay between HuR and HIF-1α expression, an interplay that may be why there is less fibroblast differentiation in response to TGF-β despite similarities in HuR binding to target mRNA. However, silencing HuR did not alter levels of secreted lactate. Thus, our data suggest that HuR has a negligible role in regulating mRNA and/or enzymes involved in the glycolytic pathway. This differential role for HuR may be related to its ability under certain conditions (i.e., hypoxia) to sequester mRNA in stress granules (SGs) [56, 60, 61]. SGs are ribonucleoprotein complexes that contain stalled mRNAs, pre-initiation factors and specific RNA binding proteins which allow cells to adapt and respond to stress [61, 62]. Studies have shown that hypoxia leads to the phosphorylation of eIF2α, resulting in the accumulation of the RNA pre-initiation complex 48S and promoting the formation of SGs [63, 64]. SGs contain HuR in addition to other RBPs that selectively bind to target mRNA with high ARE content and serve to keeping mRNA in a translationally-silent state. Formation of SGs has been associated with sequestering key components of pathways such as the NF-κB and p38/JNK pathways in response to hypoxia [65]. Thus, in response to hypoxic stress, HuR may sequester ACTA2 and Col1a1 mRNA in SGs, thereby reducing their translation and subsequent expression.
A schematic representation of the role of HuR in response to TGF-β1 and hypoxia. In response to TGF-β1 and 1% O(hypoxia), HuR translocates to the cytoplasm. HuR is crucial in the process of fibroblast differentiation and collagen production. Hypoxia greatly reduced TGF-β1-induced fibroblast differentiation and lactate production through an unknown mechanism 2
Conclusion
Our results show that HuR undergoes cytoplasmic shuttling in response to hypoxia in lung fibroblasts. HuR controls myofibroblast differentiation and ECM production but does not control metabolic reprogramming towards glycolysis. Further research is needed to understand how HuR controls pathogenic features associated with the devlopment of fibrotic lung disease.