Discovery of Ketal‐Ester Ionizable Lipid Nanoparticle with Reduced Hepatotoxicity, Enhanced Spleen Tropism for mRNA Vaccine Delivery

We hypothesized that lipids containing both the ester and ketal features could further improve their safety profiles. Accordingly, in this study, we developed a series of novel KELs (Figure1A). These newly designed KELs incorporated biodegradable ester groups and ketal groups in the tail and linker regions respectively, potentially offering improved safety profiles.

The pKa value of ionizable lipids is a critical characteristic for optimizing LNP delivery efficiency.^[7, 22^] An apparent pKa within the range of 6–7 represents an optimal window for highly efficient LNP delivery.^[21, 23^] Each lipid possesses a distinct pKa value that can be modified by altering its headgroup, linker structure, and hydrophobic tail composition accordingly. In addition, following the molecular shape hypothesis outlined several decades ago, increased branching has been postulated to facilitate endosomal escape.^[7, 24^] Therefore, we performed iterative optimization on both the head group (KEL1‐8) and tail group (KEL9‐13) to fine‐tune their pKa values and molecular shapes with the aim of obtaining lipids that exhibit enhanced delivery efficiency.

The synthesis of ketal ester lipids was accomplished through a six‐step process with purity exceeding 95%. The typical synthetic route for KEL2 is illustrated in Figure 1B. Sequential nucleophilic substitution reactions involving tosymethyl isocyanide with bromide SM1 and SM2, in the presence of K₂CO₃ and Cs₂CO₃, respectively, resulted in compound 3. Subsequent hydrolysis of compound 3 under acidic conditions yielded ketone 4. The condensation reaction between ketone 4 and butane‐1,2,4‐triol SM3 was catalyzed by pyridinium p‐toluenesulfonate (PPTS), employing a Dean‐Stark tube for efficient water removal, leading to the pivotal intermediate 5. Mesylation of compound 5 followed by nucleophilic substitution resulted in KEL2. By modifying the raw materials (SM1‐3 and dimethylamine) in this synthetic pathway, it is feasible to synthesize all ketal ester lipids.

Following the formulation methods of SpikeVax and Onpattro, all KEL LNPs were formulated with standard helper lipids: DSPC, Chol, and DMG‐PEG2000 at a molar ratio of Ionizable lipid/DSPC/Chol/DMG‐PEG2000 50:10:38.5:1.5, and at an ionizable lipid to RNA charge ratio (N/P) of 6.^[25^] The physicochemical properties of the newly formulated LNPs were characterized and presented in Table1. Particle size and polydispersity index (PDI) were determined by dynamic light scattering (DLS), apparent pKa was assessed using 6‐(p‐toluidino)‐2‐naphthalenesulfonic acid (TNS) dye‐binding assay, while encapsulation efficiency was evaluated by a RiboGreen accessibility assay. Overall, all LNPs exhibited high encapsulation efficiency (>85%), with most having hydrodynamic diameters below 100 nm and a narrow size distribution with PDI < 0.2, similar to DLin‐MC3‐DMA.

Subsequently, the formulated KEL LNPs were evaluated for their in vivo delivery efficiency (Figure 1C). Wild‐type female Balb/c mice were administered with a single dose of LNPs containing firefly luciferase mRNA (mLuci) via IV or intramuscular (IM) injection (Figure2A,B), followed by whole‐body luciferase activity assay. A control group receiving DLin‐MC3‐DMA‐based LNP was included in each experiment to facilitate comparisons across experiments.

Initially, we studied the impact of headgroups on the delivery efficiency. As shown in Figure 1A, KEL1‐4 with identical hydrophobic tails and dimethyl groups were first synthesized. KEL2 and KEL3 LNPs with two or three carbons exhibited higher potency than KEL1 and KEL4 with one or four carbons. Importantly, following IM administration, both KEL2 and KEL3 LNPs demonstrated significantly higher levels of luciferase activity than the DLin‐MC3‐DMA LNP (Figure 2A,B). It should be noted that the pKa values of both KEL1 and KEL4 are outside the reported optimal range (pKa: 6–7), which may contribute to their lower potency. We then explored KEL5‐8 with sterically large moieties at the head group of KEL2. However, KEL5‐8 LNPs showed reduced potency compared to KEL2 LNP following both IV and IM administration, suggesting that the dimethyl amine group is optimal for the head group.

Next, we investigated KEL9‐13 with distinct hydrophobic tails to explore their impacts on efficiency (Figure 1A). Notably, the tail moiety influences not only the effectiveness of delivery but also the LNP distribution pattern. For instance, Xu and colleagues reported lung‐selective mRNA delivery using so‐called “N”‐series LNPs.^[17b^] Inspired by this strategy, we synthesized KEL9 with an amide bond. However, KEL9 exhibited significantly reduced delivery potency, potentially due to its higher pKa value (pKa = 7.03). Drawing inspiration from the tail feature of ALC‐0315,^[26^] we further designed KEL10 with double‐branched tails. Unfortunately, its potency diminished compared to KEL2. Additionally, our investigation of the double primary ester lipid‐based LNP (KEL11) revealed a further decrease in potency compared to KEL10 (Figure 2A,B). It is worth noting that both KEL9 and KEL11 LNPs displayed larger particle sizes (>100 nm), which might be associated with their reduced delivery efficiency. By altering the ester direction of KEL2, two new lipids, namely KEL12 and KEL13, were obtained. The IM administration of these novel LNPs (KEL12 and KEL13) demonstrated significantly higher luciferase activity than DLin‐MC3‐DMA LNP. Interestingly, KEL12 but not KEL13 LNP also exhibited significantly higher luciferase activity than DLin‐MC3‐DMA LNP by IV (Figure 2A,C). Together, these results indicated that only some specific modulations of the tail structure support efficient delivery.

We observed a correlation between KEL pKa and LNP potency, consistent with previous studies in the field (Figure 2 and Table 1).^[22, 23^] Generally, LNPs with pKa values outside the range of 6–7, such as KEL1 (pKa 5.72), KEL7 (pKa 5.91), and KEL9 (pKa 7.03), demonstrated lower delivery efficiency for both IV and IM administration. LNPs with pKa between 6.0‐6.5 (KEL8, KEL10, and KEL13) showed lower potency than those with pKa of 6.7‐7.0 (KEL2, KEL3, KEL5, KEL6, and KEL12) after IV administration. Interestingly, as an exception, KEL4 exhibited considerable potency with a high pKa at 7.4. In terms of LNP shapes, LNPs featuring one linear and one branched tail (KEL2, KEL12, and KEL13) exhibited higher potency than LNPs with either double branched tails (KEL10) or double linear tails (KEL11) after IM or IV administration. The apparently small difference in ester direction between KEL12 and KEL13 resulted in some notable changes in not only LNP potency (Figure 2), but also several physiochemical features of LNP, including PDI, encapsulation efficiency, particle size, and pKa (Table 1). Specifically, KEL12 is better in PDI and encapsulation efficiency than KEL13. Together, we decided to prioritize further investigations on KEL12 LNP in this study thanks to its best overall performance in delivery potency and physiochemical characteristics.

Stereochemistry can generally influence the pharmacokinetics, safety, and efficacy of small‐molecule compounds.^[27^] Further, stereochemistry‐dependent interactions between LNP and target cells can affect mRNA delivery efficiency.^[28^] Since lipid KEL12 contains two chiral carbon atoms, we investigated the impact of chirality on delivery efficiency by obtaining its isomers. We synthesized (4S)‐KEL12 and (4R)‐KEL12 using a synthetic route outlined in Figure 1B with (S)‐SM3 and (R)‐SM3 as starting materials, respectively (Figure3A,B), since direct HPLC chiral separation failed to yield all four isomers of KEL12 (Figure 3B). Comparative analysis revealed improved delivery efficacy for all isomeric LNPs compared to DLin‐MC3‐DMA LNP for both IV and IM (Figure 3C‐F). However, no significant difference was observed between (4S)‐KEL12 and (4R)‐KEL12. Additionally, HPLC chiral separation of (4S)‐KEL12 yielded another two isomers, (4S, 2R)‐KEL12 and (4S, 2S)‐KEL12 specifically, without significant difference in delivery potency (Figure S1A,B).

(4S)‐KEL12 was chosen for further investigation due to easy access to raw materials. To determine its delivery efficacy, (4S)‐KEL12 LNP encapsulating a different mRNA reporter, hEPO, was assessed for its ability to express the hEPO proteins at various time points following IV or IM administration, respectively. As depicted in Figure S2, consistent with the findings from the mLuci investigation, (4S)‐KEL12 LNP exhibited a plasma hEPO protein level that is higher than DLin‐MC3‐DMA LNP but lower than SM‐102 LNP.

To further understand the profile of the new KEL LNP, we investigated the organ expression tropism of (4S)‐KEL12 LNP while using both DLin‐MC3‐DMA LNP and SM‐102 LNP as controls. After IM injection of 0.25 mg/Kg or IV injection of 1.0 mg/Kg mLuci LNPs, mouse organs were harvested after 6 h and 24 h, respectively. The tissues were subsequently measured for the average luminescence for each organ. As demonstrated by representative images and data quantifications, for all the LNPs, luciferase activity was predominantly observed in the liver and significantly in the spleen, with minimal translation in other organs, regardless of administration routes (Figure4A‐D).

In the liver, (4S)‐KEL12 LNP exhibited comparable expression to DLin‐MC3‐DMA LNP, yet significantly lower than SM‐102 LNP (left panels, Figure 4E,F). To better understand the reduced liver tropism for KEL12 LNP compared to SM‐102 LNP, we delivered KEL12 or SM‐102 LNPs encapsulating the CRE recombinase mRNA by IM in a Rosa26 transgenic mice overexpressing a CAG‐LSL‐tdTomato‐WPRE‐polyA transgene (Figure S3). The CRE recombinase expression can remove a stop codon to activate tdTomato. FACS analysis on single cell suspension showed that SM‐102 LNP led to significantly higher frequencies of tdTomato⁺ Kupffer cells and tdTomato⁺ endothelial cells than KEL12 LNP, indicating limited liver tropism at the cell type level for the KEL12 LNP after IM delivery.

In addition, protein corona can influence the distribution and expression of LNPs. Thus, we incubated mLuci LNPs with mouse plasma before evaluating their expression in the Hepa1‐6 liver cancer cell line (Figure S4). LNPs incubated with plasma showed higher expression than untreated LNPs, indicating that factors in the mouse plasma enhanced luciferase expression in Hepa1‐6 cells. Notably, regardless of plasma incubation, SM‐102 LNP demonstrated higher levels of expression than the KEL12 LNP. This result suggested an overall better ability of expression of SM‐102 LNP than of KEL12 LNP in the liver cancer cell line under the influence of protein corona in mouse plasma. Moreover, we identified 327 and 326 proteins bound on the SM102 LNP and (4S)‐KEL12 LNP through proteomics analysis, respectively (Dataset S1). Among these, 224 proteins were common to both LNPs, while each LNP had around 100 unique proteins. These unique proteins may contribute to the different expression tropism of the two LNPs. Quantitative analysis and further characterization of these unique proteins may elucidate the mechanisms behind the expression tropisms in future studies.

In the spleen, (4S)‐KEL12 LNP showed higher expression than DLin‐MC3‐DMA LNP, and is comparable to SM‐102 LNP for IV but somewhat lower than SM‐102 LNP for IM (right panels, Figure 4E,F). To further compare the specific immune cell types transfected by (4S)‐KEL12 LNP or control SM‐102 LNP, LNPs encapsulated with EGFP‐mRNA were administered via IV injection, followed by flow cytometry analysis of single‐cell suspensions from harvested spleens and inguinal lymph nodes. In the spleen, (4S)‐KEL12 LNP exhibited significantly higher efficiency than SM‐102 LNP in DCs in the spleen at 24 hrs (right, Figure 4I). Moreover, both (4S)‐KEL12 and SM‐102 LNPs showed significantly higher ratios of EGFP‐positive macrophages and DCs than the PBS control at 24 h, as well as increases in the ratios of EGFP‐positive macrophages and DCs from 6 hr to 24 hr. In the inguinal lymph nodes, for macrophages, both LNPs displayed peak transfection efficiencies at 6 hr, followed by obvious decreases at 24 hr (left, Figure 4J). For DCs in inguinal lymph nodes, however, the two LNPs demonstrated differential expression patterns. Specifically, the SM‐102 LNP group showed a reduction from 6 hr to 24 hr, but the (4S)‐KEL12 LNP group maintained the ratio roughly unchanged over time (right, Figure 4J). Given that DCs are professional APCs that can activate antigen‐specific T cells and induce effective antitumor immune responses,^[15^] (4S)‐KEL12 LNP showed advantageous features for DC expression over SM‐102 LNP. These results provided a high‐resolution picture of the improved immune organ tropism of (4S)‐KEL12 LNP. Overall, (4S)‐KEL12 LNP demonstrated enhanced expression tropism in the spleen relative to the liver compared to DLin‐MC3‐DMA and SM‐102 LNPs (Figure 4G,H), indicating the potential of (4S)‐KEL12 LNP for extrahepatic delivery, specifically for spleen‐related therapies.

One primary goal of developing ketal ester lipids was to enhance their biocompatibility. Therefore, we first assessed the cytotoxicity of (4S)‐KEL12 lipid alone and its mLuci‐LNP in cultured 293T cells, controlled by DLin‐MC3‐DMA and SM‐102. None of the lipids exhibited significant toxicity in 293T cells by themselves, with over 80% cell viability at 50 µM concentration in CCK8 assays (Figure5A). In addition, mLuci‐LNPs displayed some dose‐dependent cytotoxicity, with 50% cell viability observed at 200 ng mRNA per well in our experimental setting (Figure 5B). However, no significant differences were observed among (4S)‐KEL12, DLin‐MC3‐DMA, and SM‐102 or their respective mLuci‐LNPs in the in vitro cytotoxicity assay (Figure 5A,B).

Moreover, a dose escalation toxicity study was conducted in male and female Sprague‐Dawley rats (n = 5/group). The mLuci‐LNP formulations were administered via a single IV injection at dose levels of 0.3, 1.0, and 3.0 mg k⁻¹g (Figure 5C‐F). At a dose of 1.0 mg k⁻¹g, DLin‐MC3‐DMA LNP induced a significant increase in the ALT and AST levels compared to PBS‐treated male or female rats, suggesting hepatotoxicity. Notably, acute mortality occurred in both male and female groups treated with 3.0 mg k⁻¹g DLin‐MC3‐DMA LNP, (4/5 deaths per group), indicating severe toxicity. Both SM‐102 and (4S)‐KEL12 LNPs exhibited more favorable safety profiles in the female groups receiving up to a dosage of 3.0 mg k⁻¹g without a significant increase in ALT or AST levels. A gender difference was noted for SM‐102 LNP, as evidenced by significantly increased ALT and AST levels in males compared to females at a dosage of 3.0 mg k⁻¹g. The ALT and AST levels in (4S)‐KEL12 LNP‐treated groups were significantly lower than those in SM‐102 LNP‐treated groups at a dosage of 3.0 mg k⁻¹g for males, suggesting lower hepatotoxicity of (4S)‐KEL12 LNP. Consistently, histopathological analysis revealed liver necrosis in the DLin‐MC3‐DMA LNP group at a dosage of 3.0 mg k⁻¹g, with no significant morphological changes in the liver or spleen for either SM‐102 or (4S)‐KEL12 LNP groups (Figure 5G). Taken together, we conclude that (4S)‐KEL12 LNP displayed superior safety profiles to those of SM‐102 or DLin‐MC3‐DMA LNP.

Additionally, we investigated the toxicity of (4S)‐KEL12 mRNA‐LNP after a single IM injection at dose levels of 75 and 225 µg mRNA per rat (n = 3–5/group). For ALT, neither the male nor the female group showed significant escalation at both dosages (Figure 5H,J). Interestingly, a reduction of ALT was observed in the male rats, especially in the (4S)‐KEL12‐LNP at the 225 ug dosage (Figure 5H). For AST, under both low and high dosages in both genders, no significant difference was detected between the control and (4S)‐KEL12 ‐LNP (Figure 5K), while DLin‐MC3‐DMA LNP showed higher AST than the control in all comparisons (Figure 5I). The higher sensitivity of the males to tested LNPs than the females was consistent with the IV results. To further investigate cumulative toxicologic effects, (4S)‐KEL12 mRNA‐LNP was administered once every week for 5 doses in Sprague‐Dawley rats (n = 10/group). No significant differences were detected in ALT, AST, creatinine (Cre), or total bilirubin (TBil) levels between the control and (4S)‐KEL12 mRNA‐LNP, suggesting a lack of cumulative toxicity (Figure 5L,M). We noted that SM‐102 and MC3 LNPs showed higher toxicity in male rats than in females. Similarly, Alnylam Pharmaceuticals reported higher sensitivity in male rats with their LNP candidate ALN‐VSP, yet a correlation with distribution was not established.^[9a^] Therefore, we speculate that the increased toxicity of SM‐102 and MC3 in male rats might not be caused by different distribution.

We first tested the in vitro biodegradability of the ionizable lipids by evaluating their liver microsomal stability. The levels of ionizable lipids were measured by LC‐MS/MS at different time points. As shown in Figure6A, about 80% of SM‐102 and 84% of (4S)‐KEL12 remained after 120 minutes, suggesting similar stability under the action of human liver microsomes. We then explored the stability of (4S)‐KEL12 across several mammalian species and detected significant differences. Specifically, (4S)‐KEL12 was degraded at a similar speed in cynomolgus monkeys and rats, with only 50.5% and 47.0% remaining after 120 minutes, respectively. Its degradation rate was slower in both C57 mice and beagle dogs, with 64.0% and 64.6% remaining after 120 minutes for each species (Figure 6B). These results indicated that (4S)‐KEL12 is biodegradable. Interestingly, Alnylam also reported that rats exhibited greater sensitivity to LNP toxicity compared to mice.^[9a^] The difference in liver microsomal stability might be partially responsible for why rats are more sensitive to LNP toxicity.

We then conducted an in vivo biodegradation study of (4S)‐KEL12 LNP by measuring the levels of ionizable lipids in plasma following IV injection of mLuci LNPs (0.5 mg/Kg) in mice. During the first 6 hrs post‐injection, the levels of DLin‐MC3‐DMA or SM‐102 reduced faster than (4S)‐KEL12 (Figure 6C). This was consistent with a higher liver tropism of DLin‐MC3‐DMA and SM‐102 and the liver being the primary metabolizing organ, although other mechanisms likely also contribute. At later time points, (4S)‐KEL12 and SM‐102 maintained at relatively low levels (<10 ng/mL) after 12 hrs, and became undetectable after 24 hrs, whereas DLin‐MC3‐DMA LNPs remained at high levels at 12 and 24 hr time points. These results suggested that both (4S)‐KEL12 and SM‐102 exhibited good biodegradability.

To better understand the reduced liver expression of (4S)‐KEL12 LNP relative to SM‐102 LNP, we compared the biodistribution of the two LNPs in the liver and spleen. (4S)‐KEL12 and SM‐102 LNPs, each encapsulating a uniquely barcoded mRNA, were administered into mice at an equal molar ratio via IV, followed by tissue dissection and next‐generation sequencing (NGS) 4 hrs post‐injection. (4S)‐KEL12 LNP had significantly lower mRNA distribution in the liver and higher distribution in the spleen compared to SM‐102 LNP (Figure 6D). Decreased liver distribution was consistent with the reduced hepatic expression of (4S)‐KEL12 mRNA‐LNP (Figure 4G,H), as well as the improved safety profile of (4S)‐KEL12 LNP (Figure 5C,D).

To further characterize (4S)‐KEL12 mRNA‐LNP distribution in more detail, the levels of the (4S)‐KEL12 lipid and mRNA were measured by LC‐MS/MS and RT‐qPCR, respectively, using mouse blood and organs harvested at different times following IM injection. The peak times for mRNA and ionizable lipid levels were observed at 2 hours in most tissues, with the spleen and injection site muscle peaking at or after 6 hours (Figure6E‐H). The higher lipid levels observed in the liver, spleen, and lymph nodes, which were sustained for up to 72 hours, suggested active uptake. Tissues and organs with active uptake also showed higher expression, as demonstrated by the strong luciferase fluorescence observed in the liver and spleen in the LNP expression experiment (Figure 4). In contrast, the levels of the (4S)‐KEL12 ionizable lipid in the heart, lung, and kidney were consistently lower than in whole blood at all time points, suggesting that these organs received LNPs primarily through passive distribution via blood circulation rather than active uptake. After 120 hours, the (4S)‐KEL12 lipid was undetectable in major organs (heart, liver, lung, and kidney). This finding, along with its absence 24 hours after IV injection (Figure 6A), further confirms its good biodegradability.

The mRNA levels in the spleen and inguinal lymph nodes were significantly higher than those in the lung, heart, and kidney, consistent with the metabolic profile of (4S)‐KEL12 (Figure 6G,H,J). The mRNA levels in the liver were the lowest among all tissues, in agreement with the fact that the liver is a primary site for mRNA degradation. Furthermore, the AUCs (Area Under the Curve) of (4S)‐KEL12 and mRNA in the spleen were larger than those in the liver (Figure 6I,J), consistent with the barcode distribution results (Figure 6D). In addition, while our toxicological studies revealed no significant toxicity in either male or female rats treated with (4S)‐KEL12 LNP (Figure 5), we observed that mRNA and ionizable lipid levels were generally higher in female groups compared to male groups across various organs (Figure 6I,J).

To assess the potential advantages of (4S)‐KEL12 LNP in the development of mRNA‐based therapeutics, we evaluated the immunogenicity and anti‐tumor efficacy of (4S)‐KEL12 LNP encapsulating an mRNA encoding the E6/E7 antigens of HPV 16 and 18 as previously described.^[29^] We formulated HPV E6/E7 mRNA using (4S)‐KEL12 LNP (hereafter (4S)‐KEL12 vaccine). Cryo‐electron microscopy (cryo‐EM) revealed that the (4S)‐KEL12‐based mRNA LNP displayed a spherical morphology with multi‐layered particles (Figure7A). (4S)‐KEL12 vaccine demonstrated high encapsulation efficacywith a similar pKa value to that of mLuci (4S)‐KEL12 LNP (Figure 7B).

The anti‐tumor efficacy of the (4S)‐KEL12 vaccine was subsequently evaluated in the TC‐1 tumor model expressing HPV16 E6/E7 antigens. C57BL/6 mice subcutaneously implanted with TC‐1 tumor cells were intramuscularly administered with (4S)‐KEL12 vaccine on days 0, 7, and 14 after tumors reached an average volume of 100 mm³ (Figure 7C). (4S)‐KEL12 vaccine demonstrated comparable efficacy to the SM‐102 LNP encapsulated vaccine (SM‐102 vaccine hereafter) in tumor growth inhibition, and extending overall survival after immunization at a dose of 6.25 µg per mouse (Figure 7D). In a dose de‐escalation study, (4S)‐KEL12 vaccine further showed significant anti‐tumor efficacy at a dose as low as 1 µg per mouse (Figure 7E). It should be noted that the body weight trends for both the (4S)‐KEL12 and SM102 groups were lower than those of the PBS group (Figure 7D, middle). However, no significant difference in body weight was detected between the (4S)‐KEL12 and SM102 groups. The reduction in body weight in the vaccine‐treated groups is likely due to appetite suppression caused by the vaccines.

To understand the mechanistic insight of the observed anti‐tumor effect, we determined the immunogenicity of the (4S)‐KEL12 vaccine. Splenocytes from the 6.25 µg groups were collected one week after the last vaccination, followed by the analysis of cellular immunity. (4S)‐KEL12 vaccine significantly increased the frequency of antigen‐specific IFN‐γ⁺ or TNF‐α⁺ CD8⁺ T cells by intracellular cytokine staining (ICS) flow cytometry, indicating strong activation of antigen‐specific CD8⁺ T cell immunity (Figure 7F). Similarly, (4S)‐KEL12 vaccine resulted in a significant increase of IFN‐γ and IL‐2 by ELISpot (Figure 7G). The data were comparable between (4S)‐KEL12 vaccine and SM‐102 vaccine. These results together supported the potential application of (4S)‐KEL12 LNP in the development of mRNA‐based cancer vaccines.

SM‐102, DLin‐MC3‐DMA, and DMG‐PEG 2000 were purchased from SINOPEG. Chol and DSPC were purchased from Nippon Fine Chemical. All commercially available solvents and reagents were used without further purification. The reagents were all of analytical grade or chemically pure. Fluc mRNA and hEPO mRNA were prepared in RinuaGene Biotechnology, Co.

Balb/c mice (6‐8 weeks old, 18–22 g), Sprague‐Dawley rats (6‐8 weeks, 180–200 g), and C57BL/6 mice (6‐8 weeks old, 18–22 g) were purchased from Vital River. The C57BL/6Smoc‐Gt(ROSA)26Sor^{em(CAG‐LSL‐tdTomato)1Smoc} mice expressing a CAG‐LSL‐tdTomato transgene that can be activated by the CRE recombinase were provided by GenoBioTX (NM‐KI‐225042, GenoBioTX). The animals were kept under standard and pathogen‐free conditions (25 °C, 50 ± 10% humidity, 12‐hour dark/light cycle) with free access to food and water. Animal studies were conducted in accordance with the guidelines of the Chinese Association for Laboratory Animal Sciences and approved by the IACUC of Ascentage Pharma (Approved ethical number: AS‐20230621‐01, AS‐20240313‐01, AS‐20221228‐01).

The Human Embryonic Kidney 293T cell line and the Hepa 1–6 liver cancer cell line were purchased from the Stem Cell Bank, Chinese Academy of Sciences, and ATCC, respectively. HEK293T and Hepa 1–6 cell lines were cultured in Dulbecco's minimal essential medium (Gibco) supplemented with 10% fetal bovine serum (FBS) (Gibco) and 1% penicillin/streptomycin (Gibco). TC‐1 tumor cells transformed with HPV16 E6/E7 and c‐Ha‐ras oncogenes were kindly provided by Professor Mingzhao Zhu (Institute of Biophysics, Chinese Academy of Sciences, Beijing, China). TC‐1 tumor cells cells were maintained in RPMI‐1640 media (Gibco) supplemented with 10% FBS.

The synthetic procedures of the KELs were given in the supporting information. All KELs were characterized with ¹H NMR, ¹³C NMR, and ESI‐MS.

Lipid components (50% ionizable lipid, 38.5% Chol, 10% DSPC, 1.5% PEG‐DMG) were dissolved in ethanol, and RNA was dissolved in 20 mM sodium acetate buffer (pH 5.0). LNPs were prepared by mixing the organic phase and the aqueous phase in the T‐mixer at a total flow rate of 12 mL mi⁻¹n (aqueous/organic flow rate ratio of 3). Formulated LNPs were diluted with an equal volume of 500 mM sucrose and collected in an ultrafiltration centrifugal tube with 100 kDa NMWCO. LNPs were concentrated, and buffer exchanged with an equal volume of 2 mM acetate 250 mM sucrose buffer for 5 times. Tromethamine buffer was added to the LNPs to adjust the LNP pH to 7.5. LNPs were sterile filtered using a 0.22 µm polyethersulfone syringe filter (Cobetter, Uniflo 33), and stored at ‐20 °C prior to use.

The sizes of the LNP formulations were assessed by DLS (Malvern Zetasizer Pro). Quant‐it RiboGreen assay (ThermoFisher Scientific, Cat# R11490↗) was used to measure the encapsulation efficiency of the LNP formulations. Briefly, LNPs treated by 1% (v/v) Triton X‐100 (Adamas‐beta) to disrupt LNP structure and release mRNA and untreated LNPs were diluted to a concentration below 2 µg mRNA/mL, then reacted with an equal volume of RiboGreen assay solution at a 200‐fold dilution. Standard curves were generated within the range between 0.0 to 2.0 µg mRNA/mL using a series of free mRNA solutions with or without 1% v/v Triton X‐100. The concentrations of free mRNA and total mRNA in the formulation were determined using bulk fluorescent reading (excitation: 490 nm, emission: 535 nm) of the sample against the corresponding standard curves. The amount of RNA loaded into the LNPs (internal RNA) was calculated by subtracting the values obtained in 1 x TE (external RNA) from 1 x TE + 1% Triton X‐100 (total RNA). Subsequently, the encapsulation efficiency was calculated as the percentage obtained by dividing the amount of internal RNA by the total RNA amount.

A series of buffers with pH values varying by 1 between 3.0 and 12.0 were prepared by titrating a solution containing 10 mM citrate, 10 mM phosphate, 10 mM borate, and 150 mM NaCl with 1.0 M HCl and 0.5 M NaOH. LNPs were diluted to 75 µM ionizable lipid, TNS to 6 µM in these buffers. Fluorescence intensity was determined using a Thermo Scientific 3020 spectrophotometer (325 nm excitation/435 nm emission). With the resulting fluorescence values, a sigmoidal plot of fluorescence versus buffer pH was created. The log of the inflection point of this curve was the apparent pKa of the LNP formulation.

Balb/c mice were injected intramuscularly (0.25 mg k⁻¹g) or intravenously (1 mg k⁻¹g) with LNPs. At 6 or 24 hrs post‐administration, mice were injected intraperitoneally with 150 mg k⁻¹g of D‐luciferin monosodium salt (ThermoFisher) and imaged using the in vivo imaging system (IVIS Lumina LT Series III) 10 min post intraperitoneally. 1 × PBS (IM: 50 µL; IV: 200 µL) was injected as a negative control.

Balb/c mice were injected intramuscularly or intravenously (5 µg/mouse) with LNPs encapsulating hEPO mRNA. Blood was collected from mice via the orbital and allowed to clot at room temperature in blank tubes. The tubes were then centrifuged at 3,000 g for 10 min, and the serum samples were aliquoted and stored at ‐20 °C until analysis. hEPO concentrations were determined using a Human EPO ELISA Kit (catalog #PE230; Beyotime Biotech Inc) according to the manufacturer's instructions.

For flow cytometry analysis on single cell suspension, LNPs encapsulating mCre mRNA at a dose of 0.5 mg k⁻¹g were IM administered to the transgenic mice (GenoBioTX). After 3 days, mice were sacrificed, and livers were cut into small pieces before digestion with hyaluronidase (Absin, abs47014926) and collagenase (Absin, abs47048003) in RPMI‐1640 (Sigma, R8758‐500ML) at 37 °C. Cells were harvested by centrifugation at 1,500 rpm for 5 min under 4 °C, then resuspended in red blood cell lysis buffer (Solarbio, R1010). After incubation, 3 mL of 1x complete RPMI‐1640 media with 10% FBS was added to stop red blood cell lysis. Cells were centrifuged again for 5 min before resuspension. Cells were fixed and stained with fluorochrome‐conjugated monoclonal antibodies for cell surface markers. Liver endothelial cells were identified as CD45⁻CD31⁺, and Kupper cells were identified as CD45⁺CD31⁻F4/80. Antibodies used for flow cytometry included PerCP‐Cy5.5 Rat Anti‐Mouse CD45(30‐F11) (#550 994, BD Pharmingen), BD OptiBuild BV605 Rat Anti‐Mouse CD31 (#740 356, BD Pharmingen), APC Rat Anti‐CD11b(M1/70) (#553 312, BD Pharmingen), and BD Horizon BV421 Rat Anti‐Mouse F4/80 (#565 411, BD Pharmingen). The stained cells were washed once with PBS before flow cytometry using FlowJo v10 software.

Hepa1‐6 cells were seeded at a density of 3 × 10⁵ cells/mL in a 12‐well plate and were cultured for 16–20 h before mRNA‐LNP transfection. mLuc mRNA were encapsulated into MC3, SM102, and (4S)‐KEL12 LNP, respectively, then incubated with freshly prepared mouse serum of BALB/c at an LNP: serum ratio of 1: 2 (v/v) at 37 °C for 30 min. Subsequently, 1 µg of serum‐treated or non‐treated mLuc mRNA LNP was added into Hepa 1–6 cells. Luciferase activity was determined 6 h after LNP transfection using the Luciferase Assay System kit (Cat# E1501, Promega). The bioluminescence signals were collected using Centro Microplate Luminometer (Bethold).

100 µL of LNPs of SM102 or (4S)‐KEL12 were incubated with 100 µL of freshly‐prepared mouse serum (Balb/C, 8‐weeks old, female) at 37 °C for 30 min. LNPs were then purified using Spin‐columns for Liposome Purification (ProFoldin, #SLP20) and before LC‐MS analysis. After reduction‐alkylation followed by tryptic enzymolysis, protein samples were analyzed using liquid chromatography coupled with tandem mass spectrometry (LC‐MS/MS) at the Shanghai Majorbio Bio‐Pharm Technology Co., Ltd. (Shanghai, China).

293T Cells were maintained in DMEM (high glucose) supplemented with 10% (v/v) fetal bovine serum at 37 °C in 5% CO₂ environment. Briefly, cells (2, 000 per well) in DMEM (100 µL) were seeded overnight in 96‐well plates, then incubated with ionizable lipids at varying concentrations (0, 0.3, 1, 3, 10, 30, 100 µM for both components) or luciferase mRNA LNP in triplicates at the concentrations of 200 ng, 100 ng, and 50 ng per well, respectively. After 48 h incubation, 10 µL CCK8 was added and incubated for 2 h, and the absorbance was recorded at 450 nm using a microplate reader (BioTek, Synergy LX).

IV toxicity: (4S)‐KEL12 LNP encapsulated with luciferase mRNA was administered at 0.3, 1, or 3 mg k⁻¹g (5 Sprague‐Dawley rats /group/gender) via single intravenous bolus injection. 1.0 ml of blood was obtained 24 hours post‐dose from the jugular vein of conscious animals using manual restraint and was processed into serum. Potential test article‐related effects were evaluated by the assessment of clinical signs and serum chemistry (complete panel,7060 Automatic Analyzer (Hitachi)).

IM toxicity: (4S)‐KEL12 LNP encapsulated with E6/E7 antigens of HPV 16 and 18 was administered at 75 and 225 µg/rat (3‐5 Sprague‐Dawley rats/group/gender) via single IM injection. 1.0 ml of blood was obtained 24 hours post‐dose from the jugular vein of conscious animals using manual restraint and was processed to serum. Potential test article‐related effects were evaluated by the assessment of clinical signs and serum chemistry (complete panel,7060 Automatic Analyzer (Hitachi)).

Cumulative toxicity after IM: (4S)‐KEL12 LNP encapsulated with E6/E7 antigens of HPV 16 and 18 was administered once every week for 5 doses in Sprague‐Dawley rats (on day 1, day 8, day 15, day 22, and day 29, n = 10/group). Biochemical parameters were then tested on day 32.

The mLuci LNP was injected into the Balb/c mice through IV (1 mg k⁻¹g) or IM (0.25 mg k⁻¹g) injection, mice were injected intraperitoneally with 150 mg k⁻¹g of D‐luciferin monosodium salt (ThermoFisher). 10 mins later, mice were sacrificed, and the main organs (heart, liver, lung, spleen, and kidney) were collected and imaged using the in vivo imaging system (IVIS Lumina LT Series III).

Balb/c mice (n = 9) were intravenously (0.5 mg k⁻¹g) injected on with mLuci‐LNPs. Mouse blood was collected from three mice at each time point: 5 min, 15 min, 30 min, 1 h, 2 h, 4 h, 6 h, 8 h, 12 h, 24 h, 48 h, and 72 h. All blood samples were centrifuged at 5000 r/min for 5 min to obtain serum which was then stored at −20 °C. 30 µL of the serum was added to 90 µL of ethanol containing internal standard and the mixture was centrifuged at 12 000 r/min for 10 min to remove protein. All specimens were quantified by the LC‐MS/MS.

To determine the microsomal stability, microsomes were preincubated with ionizable lipids for 10 min at 37 °C in potassium phosphate buffer (50 mM, pH 7.4). The final incubation mixtures consisted of 0.5 mg of microsomal protein/mL liver microsomes, 5 mM MgCl₂, and 0.0025 mg/mL alamethicin in potassium phosphate buffer (50 mM, pH 7.4). The reactions were initiated with the addition of NADPH and UDPGA regenerating system. At different time points (0, 15, 30, 60, 90, and 120 min), an aliquot (50 µL) sample was taken and quenched with 200 µL of acetonitrile containing internal standard. Following precipitation and centrifugation, the supernatants were analyzed by LC‐MS/MS. This study was conducted at Safe Medical Tech Co. Ltd (Langfang, Hebei China).

Barcoded mRNA was prepared as previously described.^[32^] Briefly, DNA templates were obtained by PCR using a forward primer and reverse primers containing different barcodes for each lipid, UMI (unique molecular identifier) of a 12 nt oligonucleotide, DOCK (5′‐CTATTCGGCTATGACTGGGC‐3′), followed by purification of PCR products using Macherey‐Nagel^TM Gel and Nucleospin PCR Clean‐up (Takara Bio, Cat#740609.250). The barcodes 5′‐CCGCGGTT‐3′ and 5′‐GGACTTGG‐3′ were used for labeling SM102 and (4S)‐KEL12, respectively. Barcoded mRNA was synthesized by in vitro transcription and encapsulated into LNP of SM102 and (4S)‐KEL12. To study the in vivo biodistribution, LNP mixture (SM102‐LNP: (4S)‐KEL12‐LNP = 1:1) was injected into female BalB/c mice. Liver and spleen were collected at 4 h after injection, followed by mRNA preparation using VAHTS mRNA Capture Beads (Vazyme, Cat# N401) and library construction using Phusion High Fidelity DNA Polymerase (NEB, cat# M0530S) and VAHTS DNA Clean beads (Vazyme, cat# N411‐01). NGS were performed at Novogen (Tianjin, China) using Illumina MiSeq (Illumina), and the generated data were analyzed following the reported method.^[32^]

(4S)‐KEL12 LNP encapsulated with E6/E7 antigens of HPV 16 and 18 was administered at 75 µg/mouse (40 female and 40 male) via single IM injection. Mouse blood was collected, and organs and tissues were harvested at 2 h, 6 h, 24 h, 48 h, 72 h, 120 h, 168 h, and 336 h. The mRNA levels were quantified using RT‐qPCR, and the levels of ionizable lipid were measured using LC‐MS/MS.

The murine TC‐1 tumor cell line, which was derived from primary lung epithelial cells, immortalized with HPV16 E6/E7 and transformed with c‐Ha‐ras oncogene.^[33^] For therapeutic tumor experiments, TC‐1 cells were harvested during the exponential growth phase. Female C57BL/6 mice were injected with 5 × 10⁵ TC‐1 tumor cells subcutaneously. When the tumors reached an average of 80–110 mm³, the vaccine was intramuscularly administrated three times at one‐week intervals unless otherwise specified. Tumor sizes were measured using an electronic caliper every two to three days for calculating tumor volumes using the equation (width × width × length)/2. Animals were euthanized when either mouse showed signs of suffering or the average tumor volume exceeded 2000 mm³.

One week after the third vaccination, spleens were isolated and suspended in 2 mL RPMI‐1640 medium containing 10% fetal bovine serum (FBS). Splenocytes were stimulated with peptide pool (2 µg/mL/peptide), or medium only for ELISpot, and with 10 µg/mL brefeldin A (#B8581, Solarbio) for flow cytometry with a 20 h incubation at 37 °C. Peptides were synthesized by SBS Genetech. The ELISpot assay was conducted using the mouse IFN‐γ (#2 110 002, Dakewe) and IL‐2 (#3441‐4APW‐2, Mabtech) ELISPOT kit according to the manufacturer's instructurions. The spots of each mouse were analyzed by the Mabtech IRIS FluoroSpot/ELISpot reader.

Flow cytometry analysis was performed on the single cell suspension of splenocytes. Monoclonal antibodies against CD3, CD8α, CD4, CD44, CD62L, and CD25 for extracellular staining and antibodies against IFN‐γ, IL‐2, granzyme B, and Foxp3 for intracellular staining were purchased from BioLegend. The stimulated single cells were stained for extracellular targets at 4 °C for 30 min after viability dyes and blocking using anti‐mouse CD16/32 antibody (Biolegend). After washing, the cells were fixed and permeabilized at 4 °C for 30 min using the Foxp3 transcription factor staining buffer set according to the manufacturer's instructions (eBioscience). Intracellular IFN‐γ, IL‐2, granzyme B, and Foxp3 were stained at 4 °Cfor 1 h. After washing, the cells were resuspended in PBS and analyzed for flow cytometry using a CytoFLEX flow cytometer (Beckman Coulter).

Data from at least three independent experiments were presented as mean ± SEM. Unpaired one‐sided t‐tests, one‐way ANOVA, or MANOVA with an appropriate post‐hoc all pairwise multiple comparison test were used to determine significance as indicated in the figure legends. The number of replicates is also detailed in the figure legends. Differences were considered statistically significant when p < 0.05. Statistical analyses were performed using GraphPad Prism 8 software.