Larvicidal toxicity of Metarhizium anisopliae metabolites against three mosquito species and non-targeting organisms

Fungi infected dead A. aegypti mosquito larvae were collected from natural traps at the Sanarappatti village forest, Dharmapuri district, Tamil Nadu, India (12.0933° N, 78.2020° E). Dead mosquito larvae were washed with sterile distilled water then washed with 70% ethanol for 2-3minto remove saprophytic fungi on the surface of mosquito larvae. The dead larvae were washed with sterile distilled water then placed in sabouraud’s dextrose agar (SDA) plate and incubated for 5to 7 days at 26 ± 2°C. The grown fungi cultures were sub-cultured and pure culture was maintained at 4°C. Permission to undertake this study was granted by Periyar University. The present research does not have any evaluation/test in humans performed by any of the authors contained in this article. We followed all national and international guidelines for the use of target and non-target organisms. The Forest conservation authority in the Sanarappatti village granted permission to do sampling of the needed materials for this study.

M.anisopliae broth culture was prepared for isolation of genomic DNA (genetic material) using the method developed by Vivekanandhan and others [6]. The 100ml of Sabouraud’s Dextrose Broth culture media were prepared in 250ml of the conical flask, and then sterilized at 120°C with the help of an autoclave for 20mins. After sterilization, the media were transferred to a laminar airflow chamber. Then, 1×10⁸ conidia/ml was transferred to the liquid medium. After conidial inoculation, 0.5 g/ml of chloramphenicol was added as antibacterial agent and mixed well with culturing medium, the culturing medium was incubated at 26°C for 10 days.

After incubation the fungus biomass was removed from the culturing medium using Whatman No. 1 filtering paper then fungal biomass were washed with double distilled water for remove the unwanted materials from the medium. Fungal biomass 500g was transferred to 1000 ml glass beakers contains 750ml of ethyl acetate solvent, which was mixed with the fungal mycelial mat for cold extraction for 15 days at 28±^oC. Subsequent to complete crude secondary metabolites extraction the light-yellow color portion (organic phase) was separated from fungal mat using Whatman No.1 paper. Collected acetate extracts crude extract were then concentrated using a vacuum evaporator (Superfit-R/150/11, Mumbai, India).

Fungi were grown in 100ml of sabouraud’s dextrose broth (SDB) in 150ml of culturing medium which was incubated at (26±2^o C)for up to 5 days. After 5 days fungi mycelia filtered using Whatman no.1 filter paper and fungal mats were used for isolation of genomic DNA as described by Vivekanandhan and others [6]. Five grams (5g) of M. anisopliae biomass was ground with liquid nitrogen using sterile mortar with pestle. Then, 1.5ml freshly prepared CTAB buffer was added to grinded fungal mycelium. The mixture was transferred to sterile centrifuge tubes and placed in water bath at 62^o C for incubation for the period of 1 hr. After complete incubation time, tubes were transferred to cooling condition of 4°C for 15mins, then tubes were centrifuged at 8,000rpm for 12mins (Remi cooling centrifuge-C-24BL, India).After centrifugation DNA pellet was taken and the supernatant was discarded. The pellet was washed with 70% ethanol then air-dried. Pure genomic DNA was taken for purity confirmation.

Genomic DNA was amplified, using forward (GTAGTCATATGCTTGTCTC) and reverse (CTTCCGTCAATTCCTTTAAG). PCR amplification reactions were carried out in a 20μl of PCR master mix contained 1X PCR buffer, 0.2mM each dNTPs, 1.5 μl DNA, 0.2 μl Phire Hotstart II DNA polymerase enzyme, 0.1 mg/ml BSA and 3% DMSO, 0.5M Betaine, 0.2 μl of forward and reverse primers. Polymerase chain reaction temperatures followed, initial stage at 95°C 5mins; denaturing at 94^o C for 30°C and annealing temperature was 50°C for 30 seconds; elongation temperature at 72°C for 2 mins and extension temperature at 72°C with 7mins.

Sequence quality was confirmed by using sequence scanner software version-1.0 connected with a personal computer, the sequence editing and alignment were carried out by using Geneious Professional version-5.1.

An. stephensi, Ae. Aegypti and Cx. quinquefasciatus larvae were obtained from the Institute of Vector Control Zoonoses, Hosur, Tamil Nadu, India. The larval rearing was maintained at temperature of 26±2°C, 70–80% relative humidity and 14:10 light and dark photoperiod. Larvae were fed with Eleusine coracana millet powder for proper growth and development.

Eudrilus eugeniae stock was maintained at a temperature of 27 ±2°C in Molecular Entomology Laboratory, Periyar University, Salem, Tamil Nadu, India. Artemia nauplii larvae were maintained in 1000 ml of seawater and salinity maintained at 30 parts per trillion in culture medium with pH range of 7–8 and photoperiod 17:7 light and dark. The temperature was 27 ±2°C and oxygen was supplied by aspirator.

Larval toxicity test was carried out as per the method developed by World Health Organization, [4, 5, 14]. Five different fungal concentration (0.5, 10, 25, 50 and 75μg/ml) were tested with 25 larvae of 3^rd instars larvae of mosquito species. For each concentration three replicates were tested. Control was treated with DMSO as a negative control. After 24 hr post-treatment, the dead larvae were counted. Mortality was calculated using Abbott’s formula, 1925 and Probit analysis calculated [15].

Mature A. nauplii were collected with hand pipette and used for toxicity assays under different M. anisopliae, B. bassiana and V. lecanii metabolites concentrations (0.5, 10, 25, 50 and 75μg/ml). DMSO only solution was used as control. The mortality of the A.nauplii was recorded after 24 hr. Three replicates for each concentration were performed.

Artificial soil contains 25% kaolinite clay, 15% sphagnum peat, 75% fine soil was taken for artificial soil toxicity tests following OECD guideline [16]. Few drops of CaCO₃ were added to regulate the pH to 6.0 ± 0.2. Soil water content was maintained for 30–32%. The soil was prepared by adding different concentrations of fungi extract and chemical insecticide (100μg/kg and 500μg/kg) on a dry weight basis. Fifteen (15) adult E. eugeniae was transferred to 1000g filled with test substrate with desired concentration and bioassay containers were closed with a proper lid for preventing the E. eugeniae escapes. After 24days exposure time, the dead E. eugeniae were counted. Each concentration had three replicates and one replicate had ten E. eugeniae. The control set without any fungal extract and replicated thrice.

After 24hr post-treatment of fungi crude metabolites the exposed E. eugeniae (treatment) and unexposed (control) were separately fixed with 4% formalin for 2-6hr at 4°C. Blocks were cooled at 25°C for 3hr then slash into 3μm thickness, with 0.5 mm ribbons, using a microtome (Leica, Germany). E.eugeniae was stained with Ehrlich’s hematoxylin and eosin. The dried slides were observed under a light microscope (Olympus-CH20i/India), with 100X and 400X magnifications.

After 24hr treatment mortality of target mosquito and non-target species, earthworm was calculated by using Abbott’s formula, 1925 [15]. Lethal concentration of mosquito larvae, E. eugeniae were calculated and their LC₅₀ values and chi-square tests were done using SPSS (Inc., Chicago, USA) version 25.0 for analyses the derived results and the significance (P < 0.05) levels.

M.anisopliae fungi and their morphological were characterized. The results clearly show that the conidial color is dark green in color and their conidial structure is slender in shape (Fig 1). Based on morphological verification the fungus culture was conformed as Metarhizium genus.

M. anisopliae genomic DNA was amplified using the polymerase chain reaction (PCR) with 18s rDNA universal primer. The M. anisopliae fungi sequence was deposited in the National Center of Biotechnology Information (NCBI) database, and their accession number is NCBI (MH165400.1↗). M.anisopliae18s rDNA sequence was 100% match with M. anisopliae species. Based on these results, isolated fungi culture was conformed as M. anisopliae. Neighbor-joining tree method was used for identification of M. anisopliae their taxonomy and evolution (Fig 2).

The significant differences in mortality rates were observed on larvae of Ae. Aegypti (Fig 3) An. stephensi (Fig 4) and Cx. Quinquefasciatus (Fig 5) mosquitoes in laboratory conditions at 24hr post treatment. The M. anisopliae metabolites cause mortality of larval varying from 22 to 85% (F = 660.3, P < 0.001, df = 12) in A. aegypti, for An. stephensi varied from 33 to 97% (F = 748.7, P < 0.001, df = 12) while for Cx. quinquefasciatus varied from 21 to 89% (F = 466.1, P < 0.001, df = 12) (Table 1). M.anisopliae crude metabolites produced lower LC₅₀ values in A. aegypti (LC₅₀, 59.83μg/ml for An. stephensi(LC₅₀, 50.16μg/ml) and Cx. quinquefasciatus (LC₅₀, 51.15μg/ml) (Table 1).

Results showed the presence of five major chemical constituents namely, Hexatriacontane (15.46%), 9-octyl eicosane (9.10%); Heptacosane (6.48%); Heptacosane (4.99%); (Z,Z)-3,6-cis-9,10-Epoxyheptadecadie (2.53%) as major and active compounds (Fig 6).

Major functional groups identified using FT-IR analysis of M. anisopliae crude metabolites showed peaks range from 3952.19 to 495.02. These findings demonstrate that, M. anisopliae crude metabolites contain major functional group namely; Alcohols and Carboxylic acids. Major broad peaks were observed in 3952.19cm-1 this wave number assigned to O–H stretching, 3592.61cm-1 wave number assigned to = NOH (OH stretching) and 495.02cm-1 wave number assigned to S-S disulfide asym (Table 2).

The lowest lethal toxicity was observed in E. eugeniae and limited mortality was observed in M. anisopliae compared to Monocrotophos at after 24hrpost-treatment. Eighteen percent (18%) mortality observed in M. anisopliae, 97% mortality in Monocrotophos and 4% mortality in control. The highest E. eugeniae mortality was observed in Monocrotophos pesticide treatment that recorded 97% (Fig 7).

Sub-lethaleffect was observed in E. eugeniae gut tissues after 24hr post-treatment. At 100μg/ml of M. anisopliae fungi crude metabolites produced lower damage to gud tissues namely, intestinal lumen and intestine compared to Monocrotophos (Fig 8). The thickness of the epidermis, intestinal epithelium and the body wall of E. eugeniae were evaluated after treatments (Table 3).

M.anisopliae fungi crude metabolites showed lower toxicity on the non-target species A. nauplii than mosquitoes. The results of M.anisopliae derived crude metabolites indicated low (less than 20%) mortality on A. nauplii at 24hr post treatment (F = 325.0, Df = 12,P = 0.001) (Fig 9). The LC₅₀ values were, 54.96μgml for the treatment of M.anisopliae derived secondary metabolites (Fig 10). No behavioral changes were observed during the treatment.

Thirty dayspost-treatment in semi-field level application our results clearly showed that high yield of flowers, more root and shoot length and no bacterial and fungal infection was observed compared with control. Fungi crude metabolite toxicity was not observed on treated tomato plant (Solanum lycopersicum L).

All relevant data are within the paper.