A lipid nanoparticle-based mRNA vaccine elicits immunity against porcine circovirus type 2 in mice

HEK-293T cells (ATCC CRL-3216) were maintained in Dulbecco’s modified Eagle’s medium (Gibco, USA) containing 10% fetal bovine serum (FBS; Excell, Australia). The cells were incubated under standard culture conditions at 37°C in a humidified atmosphere of 5% CO₂. The PCV2 strain used in this study was PCV2b (GenBank accession no. KT719404.1↗), propagated and titrated in PK-15 cells. Virus stocks were prepared from infected cell culture supernatants, aliquoted, and stored at −80°C until use.

A synthetic gene encoding the full-length Cap protein of PCV2b was designed through comprehensive codon optimization to maximize translational efficiency in mammalian systems (29). The optimized coding sequence was subsequently cloned into a pUC57-derived mRNA expression plasmid under the transcriptional control of a T7 promoter. The expression cassette was flanked by optimized untranslated regions (UTRs): a 5′UTR and a 3′UTR derived from sequences known (α-globin) to enhance mRNA stability and translational efficiency. Additionally, a synthetic polyA tail of approximately 100 nucleotides was incorporated downstream of the 3′UTR to further promote transcript stability. The mRNA was prepared by Beijing Hemu Biotechnology Co., Ltd. Briefly, the plasmid construct was linearized downstream of the expression cassette and served as a template for in vitro transcription (IVT) using T7 RNA polymerase (Yeasen, Cat. 10618ES90). The IVT reaction was supplemented with the co-transcriptional capping agent Cap1-GAG m7G(5′)ppp(5′) (2′0MeA)pG (Yeasen, Cat: 10677ES60) to ensure a high-fidelity 5′ cap structure, and N1-methylpseudouridine (Yeasen, Cat. 13860-38-3) was incorporated universally in place of uridine to mitigate innate immune sensing and enhance translational efficiency. Following transcription, the mRNA was purified using lithium chloride precipitation (Thermo Fisher, Cat. AM9480) to remove enzymatic reagents and abortive transcripts, and its integrity, purity, and molecular size were confirmed by analytical agarose gel electrophoresis.

The PCV2 Cap mRNA and CpG ODN were encapsulated into LNPs utilizing a precision microfluidic-based assembly approach, respectively (30). The optimized LNP formulation comprised four functional lipid components: the ionizable cationic lipid Heptadecan-9-yl 8-([2-hydroxyethyl] [6-oxo-6-(undecyloxy) hexyl] amino) octanoate) (Sinopeg, China, Cat. 2089251-47-6) for mRNA complexation and endosomal disruption, 1,2-distearoyl-sn-glycero-3-phosphocholine (Sinopeg, Cat. 816-94-4) as a structural phospholipid, cholesterol (Sinopeg, Cat. 57-88-5) to enhance membrane stability and fluidity, and Methoxypoly (ethylene glycol) dimyristoyl glycerol (DMG-PEG 2000; Sinopeg, Cat. 160743-62-4) to confer steric stabilization and reduce nonspecific interactions—combined at an empirically determined molar ratio of 50:10:38.5:1.5 (31). During the assembly process, an aqueous phase containing mRNA in citrate buffer (pH 4.0) and an organic phase consisting of the lipid mixture in ethanol were simultaneously injected into a microfluidic chip at a controlled 3:1 volumetric ratio, enabling rapid mixing and spontaneous nanoparticle formation through a microfluidic device (Fluidiclab, China, Model NP-S2). This step was entrusted to Beijing Hemu Biotechnology Co., Ltd. for completion. The resulting mRNA-LNP suspension was subjected to extensive dialysis against phosphate-buffered saline (PBS, pH 7.4) to remove residual ethanol, accomplish buffer exchange, and ensure colloidal stability. The physicochemical properties of the purified LNPs, including hydrodynamic diameter, polydispersity index (PDI) as a measure of size distribution homogeneity, and zeta potential as an indicator of surface charge, were characterized using dynamic light scattering on a Zetasizer Nano ZS instrument (Denovix, Model: DS-11). Additionally, morphological attributes and structural integrity of the LNPs were visualized by transmission electron microscopy (TEM; Hitachi, Japan) (32).

The gene encoding the PCV2 Cap protein was cloned into a pET-28a(+) vector, generating an N-terminal 6×His-tagged construct, and transformed into E. coli BL21(DE3) cells (TransGen, China, Cat. CD601-02). Expression was initiated by growing the transformed cells in LB medium with kanamycin at 37°C to an OD600 of 0.6–0.8, followed by induction with 0.5 mM isopropyl-β-D-thiogalactopyranoside (Yeasen, Cat. 10902ES08) and subsequent overnight incubation at 18°C to enhance soluble protein production. Cells were then harvested by centrifugation, resuspended in lysis buffer containing lysozyme and protease inhibitors, and lysed by sonication on ice. The clarified lysate, obtained by high-speed centrifugation, was applied to a Ni-NTA affinity column (Thermo Fisher, Cat. 88226) pre-equilibrated with lysis buffer. After extensive washing with buffer containing 50 mM imidazole, the His-tagged PCV2 Cap protein was gradient eluted using elution buffer containing 100, 200, and 500 mM of imidazole. The eluate was subsequently dialyzed into a suitable storage buffer, analyzed by sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) for purity, and stored at –80°C.

For western blot analysis, membrane and cytosolic proteins were extracted using a commercial kit (Beyotime, Cat. P0033) from harvested HEK-293T cells transfected with PCV2 Cap mRNA-LNPs. The protein concentrations were quantified via bicinchoninic acid assay to ensure equal loading. Subsequently, the protein samples were denatured, separated by SDS-PAGE under reducing conditions, and electrophoretically transferred onto a polyvinylidene difluoride (PVDF) (Thermo Fisher, Cat. 88518) membrane to immobilize the resolved proteins. The membrane was then subjected to a blocking step with 5% non-fat milk in Tris-buffered saline containing 0.1% Tween-20 (TBST) to minimize non-specific antibody binding. For immunodetection, the membrane was probed with a mouse-derived anti-PCV2 Cap monoclonal primary antibody (1:5,000 dilution; Kemiao, Cat. KMA0232142R), followed by extensive washing and subsequent incubation with a horseradish peroxidase (HRP)-conjugated goat anti-mouse IgG secondary antibody 1:10,000 dilution (TransGen, Cat: HS201-01). Following additional washes to remove unbound antibodies, specific protein bands were visualized using an enhanced chemiluminescence substrate (Beyotime, Cat: P0018S), and the resulting chemiluminescent signals were captured digitally using a chemiluminescence imaging system (Bio-Rad, ChemiDoc imaging system).

All animal experiments were performed under protocols approved by the Institutional Animal Care and Use Committee (IACUC) of Daoke Pharmaceutical Technology (Beijing) Co., Ltd. (approval no. IACUC-DKBJ-2024-10-11-05) and conducted in strict compliance with relevant ethical guidelines for animal research.

For the mRNA vaccine, 20 female BALB/c mice, aged 6–8 weeks, were acclimatized for 1 week prior to randomization into defined experimental groups (n = 5 per group). The immunization regimen consisted of a prime-boost strategy administered via the intramuscular route on day 0 (prime) and day 14 (boost). Each mouse received a 100 µL i.m. injection containing one of the following: 10 µg of PCV2 mRNA-LNP, 10 µg of recombinant Cap protein formulated with a suitable Al(OH)₃ adjuvant (Sigma, Cat. 12352305), an equivalent volume of PBS serving as a blank control, and 10 µg of inactivated vaccine (PULIKE Biotech, China) serving as a positive control. Blood samples were collected at predefined intervals via retro-orbital bleeding, and serum was isolated for subsequent serological profiling. Two weeks after the booster immunization, animals were humanely euthanized, and spleens were aseptically excised for the isolation of splenocytes to enable comprehensive evaluation of antigen-specific cellular immune responses.

For CpG ODN and mRNA vaccine, 15 female BALB/c mice, aged 6–8 weeks, were randomly divided into three groups (n = 5 per group). The immunization regimen consisted of a prime-boost strategy administered via the intramuscular route on day 0 (prime) and day 14 (boost). CpG ODN LNP was administered intramuscularly at the same site (leg) 1 h after the mRNA-LNP injection (TCGTCGTTGTCGTTCGGGCGGCG, thioylation modification, Tsingke, China). This staggered administration protocol was designed to allow initial cellular uptake and translation of the mRNA vaccine prior to the potent immunostimulatory signal from the TLR9 agonist, potentially optimizing the synergistic induction of adaptive immunity (33). Each mouse received either a 100 µL i.m. injection of 10 µg PCV2 mRNA-LNP, or 10 µg of PCV2 mRNA-LNP, followed 1 h later by a second 50 µL i.m. injection at the same site containing 2.5 µg of CpG ODN-LNP (TCGTCGTTGTCGTTCGGGCGGCG, thio modification, Tsingke, China) or an equivalent volume of PBS serving as a negative control.

For the safety assessment, female BALB/c mice (6–8 weeks old, n = 5 per group) were randomly assigned into three groups and received a single 500 µL intraperitoneal injection of either PBS, 50 µg of the mRNA-LNP formulation, or a co-formulation containing 40 µg of mRNA and 10 µg of CpG ODN (34). At 14 days post-injection, blood was collected from all mice for serum biochemical analysis, after which the animals were humanely euthanized. Major organs (including heart, liver, spleen, lungs, and kidneys) were then harvested for gross anatomical observation and photography, followed by histopathological examination via hematoxylin and eosin (H&E) staining.

For the prediction of epitopes within the PCV2 sequence, a comprehensive in silico analysis was performed. B-cell epitopes were predicted using the Immune Epitope Database (IEDB) analysis resource (http://tools.iedb.org/main/bcell/↗) (35). Specifically, both the Kolaskar and Tongaonkar antigenicity method (default threshold: 1.0) and the Bepipred Linear Epitope Prediction 2.0 algorithm (default threshold: 0.5) were employed to identify linear epitopes (36, 37). For T-cell epitopes, predictions for MHC class I and MHC class II binding affinity were conducted using the IEDB-recommended consensus approach with default parameters (http://tools.iedb.org↗) (38). Additionally, cytotoxic T lymphocyte (CTL) epitopes were directly predicted using the NetCTLpan 1.1 server (https://services.healthtech.dtu.dk/services/NetCTLpan-1.1/↗), which integrates MHC class I binding, proteasomal cleavage, and TAP transport efficiency (39). Ultimately, to ensure high confidence in the selection, peptides that were identified as overlapping hits by all four prediction methods were prioritized for further investigation.

To quantify antigen-specific antibody responses, an indirect enzyme-linked immunosorbent assay (ELISA) was systematically performed. Briefly, 96-well high-binding microplates were coated with recombinant PCV2 Cap protein at a concentration of 100 ng per well in carbonate-bicarbonate coating buffer (pH 9.6) and incubated overnight at 4°C (40). Following coating, plates were thoroughly washed with PBS containing 0.05% Tween-20 (PBST) and subsequently blocked with 5% (wt/vol) non-fat dry milk prepared in PBST for 2 h at 37°C to prevent non-specific binding. Serial dilutions of mouse serum samples, prepared in blocking buffer, were added to the plates and incubated for 1 h at 37°C. After extensive washing, the plates were probed with an HRP-conjugated goat anti-mouse IgG secondary antibody diluted in blocking buffer for 1 h at 37°C (41). Following a final wash cycle, colorimetric development was initiated by adding 3,3′,5,5′-tetramethylbenzidine substrate (Beyotime, Cat. P0206-100ml), and the enzymatic reaction was terminated with 2M sulfuric acid (Beyotime, Cat: P0215). Absorbance was immediately measured at 450 nm using a microplate reader, with 630 nm as the reference wavelength (Thermo Fisher, Model VWD-3400RS). The endpoint antibody titer for each sample was rigorously defined as the highest serum dilution factor that yielded an OD450 value exceeding 2.1 times the mean value obtained from negative control sera. The starting dilution was used as the nominal titer for the antibody-negative PBS control group, thus defining the detection baseline.

For the virus neutralization assay, heat-inactivated mouse sera (56°C for 30 min) were subjected to serial twofold dilutions in serum-free maintenance medium. Each dilution was combined with an equal volume of PCV2 viral suspension standardized to contain 200 TCID₅₀ per 50 μL, resulting in a final challenge dose of 100 TCID₅₀ per well. The serum-virus mixtures were incubated for 60 min at 37°C in a 5% CO₂ atmosphere to permit antibody-virus interaction. Following incubation, 100 μL of each mixture was transferred onto confluent PK-15 cell monolayers cultured in 96-well tissue culture plates and adsorbed for 1 h at 37°C (42). The inoculum was subsequently replaced with fresh maintenance medium supplemented with 2% FBS, and the cells were further incubated for 72 h to allow viral replication (43). Post-incubation, cells were fixed with 80% acetone, and viral infection was detected through an immunoperoxidase monolayer assay using a PCV2-specific monoclonal primary antibody (Kemiao, Cat: KMA0232142R) followed by an HRP-conjugated secondary antibody, with 3,3'-diaminobenzidine (Beyotime, Cat: C0085S) as the chromogenic substrate. The neutralization titer (NT₅₀) was quantitatively determined as the reciprocal of the maximum serum dilution that achieved ≥50% reduction in the number of virus-infected foci compared to the virus control wells, calculated using the Reed-Muench method.

To assess the frequencies of total CD4⁺ and CD8⁺ T cell populations, splenocytes were isolated from immunized mice. Single-cell suspensions were prepared and seeded in 96-well U-bottom plates. The cells were first stained for viability using a fixable viability dye, then incubated with anti-mouse CD16/32 antibody to block Fc receptors prior to surface staining with fluorochrome-conjugated antibodies specific for CD45-Alexa Fluor 700 (BioLegend, Cat: 157210), CD4-FITC (BioLegend, Cat: 100509), and CD8a-PerCP-Cy5.5 (BioLegend, Cat: 100733).

For analysis of germinal center (GC) B cells and T follicular helper (Tfh) cells, inguinal lymph nodes were harvested and processed into single-cell suspensions by passing them through a 70 µm cell strainer (44). Cells were washed and resuspended for staining. The cells were first stained with Ghost Dye Red 780 (TONBO Biosciences, Cat. . 13-0865-T100) for dead cells and then stained with a cocktail of the following fluorescently labeled antibodies: anti-CD45-Alexa Fluor 700 (BioLegend, Cat. 157210), anti-CD4-FITC (BioLegend, Cat. 100509), anti-CD185-Brilliant Violet 605 (BioLegend, Cat. 145513), anti-PD-1-Brilliant Violet 421 (BioLegend, Cat. 135221), anti-B220-PerCP-Cyanine5.5 (BioLegend, Cat. 103236), anti-CD95-PE (BioLegend, Cat. 152608), and anti-GL-7-APC (BioLegend, Cat. 144618) in cell staining buffer and incubated for 20 min in the dark at room temperature.

Data for all samples were acquired on a BD FACSymphony flow cytometer (BD Biosciences) and analyzed using FlowJo software (v10.8).

Antigen-specific T cell responses were quantitatively evaluated using an enzyme-linked immunospot (ELISpot) assay for IFN-γ (Mabtech, Cat: CVL-KIT30236↗) and interleukin 4 (IL-4; Mabtech, Cat. CVL-KIT30231↗) secretion, performed with a commercial ELISpot kit in strict accordance with the manufacturer’s standardized protocol (45). Briefly, 96-well PVDF-backed plates were pre-coated with an anti-IFN-γ or anti-IL-4 monoclonal capture antibody and incubated overnight at 4°C (46). Following plate blocking with complete RPMI-1640 medium, freshly isolated splenocytes were seeded in duplicate wells at a density of 2.5 × 10⁵ cells per well and stimulated with the PCV2 Cap peptide pool (0.5 μg/mL per peptide and 4.5 μg/mL in total). After 24–48 h of incubation at 37°C in a 5% CO₂ humidified atmosphere, cells were carefully removed by extensive plate washing. The detection phase involved sequential incubation with a biotinylated anti-IFN-γ or anti-IL-4 detection antibody, streptavidin-alkaline phosphatase conjugate, and finally the BCIP/NBT chromogenic substrate to develop distinct purple spots at the sites of cytokine secretion. The developed plates were air dried, and the number of antigen-specific spot-forming units was automatically enumerated using an AID iSpot Spectrum ELISpot reader system.

All quantitative data derived from experimental replicates are expressed as mean ± standard deviation (SD). For comparisons encompassing three or more independent experimental groups, statistical significance was determined by one-way analysis of variance. All statistical analyses were performed using GraphPad Prism software (version 8.0; GraphPad Software, USA).

For the development of an mRNA vaccine platform against PCV2, the full-length Cap protein serving as the principal structural component and dominant immunogen of the virus was selected as the target antigen. The corresponding mRNA construct was designed to incorporate key regulatory elements: a 5′ cap1 structure to promote ribosomal binding and reduce innate immune recognition, optimized 5′ and 3′ UTRs to improve transcript stability and translational efficiency, a codon-optimized Cap protein for high-level expression in mammalian cells, and a defined poly(A) tail to enhance mRNA stability (Fig. 1A). The mRNA was synthesized by in vitro transcription using N1-methylpseudouridine to minimize innate immune activation, purified to pharmaceutical grade, and efficiently encapsulated into LNPs via a microfluidic-based process.

TEM further corroborated these findings, revealing spherical nanoparticles with uniform morphological characteristics and intact structural integrity (Fig. 1B). Comprehensive physicochemical characterization demonstrated that the formulated mRNA-LNPs possessed a mean hydrodynamic diameter of 100 nm, with a narrow PDI of 0.210 ± 0.068 (Fig. 1C), confirming a homogeneous, monodisperse nanoparticle population optimal for cellular uptake. Functional validation of antigen expression was conducted through transfection of HEK-293T cells with PCV2 mRNA-LNPs, with western blot analysis of resultant cytosol and membrane fractions revealing a distinct immunoreactive band of approximately 32 kDa, corresponding precisely to the predicted molecular mass of the full-length Cap protein (Fig. 1D).

The recombinant His-tagged PCV2 Cap protein was successfully purified. Analysis by SDS-PAGE revealed a predominant protein band in the fractions eluted with buffer containing 500 mM imidazole. The observed molecular weight of this band corresponded well with the theoretical size of the PCV2 Cap protein. Furthermore, the identity of the protein was confirmed by western blot analysis using an anti-Cap antibody, which yielded a specific immunoreactive signal at the expected size, thus verifying the successful expression and purification of the Cap protein (Fig. 1E).

Based on the PCV2 sequence, B-cell epitope prediction was initially performed using the IEDB database. Antigenic epitopes were predicted via the Kolaskar and Tongaonkar method with a default threshold of 1.0. Subsequently, linear B-cell epitopes were identified using Bepipred Linear Epitope Prediction 2.0 under a default threshold of 0.5 (Fig. 1F). For MHC class II and class I molecular binding site prediction, the IEDB database (http://tools.iedb.org↗) was employed with selection criteria set at IC₅₀ < 100 nM for swine alleles and IC₅₀ < 5,000 nM for murine alleles. Furthermore, CTL epitopes were directly predicted using the NetCTLpan tool (https://services.healthtech.dtu.dk/services/NetCTLpan-1.1/↗). Finally, by intersecting the results obtained from the four prediction approaches, a set of overlapping peptides was selected, culminating in the identification of five peptides for swine alleles and four peptides for murine alleles (Fig. 1G).

Next, we evaluated the immunogenicity of the PCV2 Cap mRNA-LNP vaccine in mice. Female BALB/c mice were randomly allocated into three experimental groups and administered two intramuscular injections of either 10 µg of the mRNA-LNP formulation, 10 µg of recombinant Cap protein with Al(OH)₃ adjuvant, or PBS as a negative control (Mock group, Fig. 2A). Serum samples were systematically collected to evaluate the humoral immune responses. ELISA demonstrated that the mRNA-LNP vaccine induced a robust and sustained humoral response, with post-boost Cap-specific IgG antibody titer (geometric mean titer, GMT = 1:18,379) significantly surpassing those elicited by both the protein subunit vaccine (GMT = 1:3,676, P < 0.001) and the PBS control group (GMT = 1:25, P < 0.0001; Fig. 2B). More strikingly, subsequent analysis of serum neutralization potency revealed that the mRNA-LNP platform generated substantially elevated virus-neutralizing antibody titer (GMT = 1:141), exhibiting a marked superiority over the immunogenicity profile achieved by the conventional subunit vaccine approach (GMT = 1:51, P < 0.001; Fig. 2E).

To assess cellular immunity, we isolated splenocytes from immunized mice following the prime-boost regimen and analyzed them by flow cytometry. Flow cytometry showed a significant increase in antigen-responsive CD4⁺ T cells in the mRNA-LNP immunized group compared to both the protein subunit (P < 0.01) and PBS control groups (P < 0.0001; Fig. 2C). Similarly, the frequency of antigen-specific CD8⁺ T cells was significantly higher in the mRNA-LNP group than in the subunit (P < 0.01) and PBS control (P < 0.0001) groups (Fig. 2D and J).

To evaluate the induction of high-affinity, long-lived humoral immunity, which critically depends on the GC reaction and the help provided by Tfh cells, we analyzed the frequencies of these cell populations in draining lymph nodes. Our results demonstrated that immunization with the mRNA vaccine significantly expanded both GC B cells and Tfh cells upon antigen recall, and this response was markedly superior to those induced by either the Cap protein subunit or the PBS control (Fig. 2F, G, J, K and L). Representative flow cytometry gating plots were provided in Fig. S1.

ELISpot analysis showed that splenocytes from vaccinated mice produced many more IFN-γ-secreting cells after stimulation with PCV2-derived peptide pools, with the response magnitude significantly exceeding the response observed in the protein subunit (P < 0.001) and PBS control (P < 0.0001) groups (Fig. 2H, I and M).

Taken together, these coordinated investigations provide compelling evidence that the PCV2 Cap mRNA-LNP vaccine platform induces a potent and comprehensive cellular immune response characterized by the robust activation of CD4⁺ T and CD8⁺ T lymphocytes, GC B and Tfh cells, and antigen-specific IFN-γ production.

Building upon the promising immunogenicity of the PCV2 Cap mRNA-LNP vaccine, we next sought to investigate whether its efficacy could be further augmented by incorporating a molecular adjuvant. To this end, we formulated a new candidate by combining the mRNA-LNP with CpG ODN oligodeoxynucleotides, a well-characterized TLR9 agonist known to potentiate both innate and adaptive immunity (47). Female BALB/c mice were randomly divided into three groups receiving: PBS (Mock control), standard mRNA-LNP, or mRNA-LNP co-injected with CpG ODN (Fig. 3A).

The inclusion of CpG ODN significantly enhanced the immunogenicity of the mRNA-LNP platform. Evaluation of humoral responses revealed that the mRNA + CpG ODN combination group induced the highest levels of Cap-specific IgG antibodies (GMT = 1:38,803), with titer significantly exceeding those in the standard mRNA-LNP group (GMT = 1:16,889, P < 0.01) and PBS control (GMT = 1:400, P < 0.0001; Fig. 3B). Crucially, this enhanced binding antibody response translated into superior functional immunity, as evidenced by the highest virus-neutralizing antibody titer being achieved in the mRNA + CpG ODN group (GMT = 1:192) compared to the mRNA-LNP alone (GMT = 1:128, P < 0.01) and PBS control (GMT = 1:2, P < 0.0001; Fig. 3C).

CpG ODN also strongly enhanced cellular immune responses. Multiparameter flow cytometric analysis of splenocytes demonstrated that the frequencies of antigen-specific CD4⁺ T cells (P < 0.05) and CD8⁺ T cells (P < 0.05) were significantly higher in the mRNA + CpG ODN group compared to the standard mRNA-LNP group (Fig. 3D through F). This enhanced T cell activation provided a more favorable milieu for B cell help, which was confirmed by a significant increase in the populations of GC B cells (P < 0.05) and Tfh cells (P < 0.05) in the draining lymph nodes of the mRNA + CpG ODN immunized mice (Fig. 3G through J). Furthermore, ELISpot analysis confirmed that splenocytes from the mRNA + CpG ODN group produced a substantially greater number of IFN-γ spot-forming cells upon peptide stimulation than those from any other group, including the standard mRNA-LNP (P < 0.01) and PBS control (P < 0.0001; Fig. 3K through N).

In summary, the co-delivery of CpG ODN oligodeoxynucleotides with the PCV2 Cap mRNA-LNP vaccine profoundly enhanced the magnitude of both humoral and cellular immune responses. The significantly elevated levels of neutralizing antibodies, coupled with the robust expansion of T cell subsets, GC B cells, and Tfh cells, underscore the critical role of CpG ODN as a potent adjuvant. This combination strategy successfully creates a more immunogenic milieu, driving a comprehensive and potent immune response superior to the mRNA-LNP alone.

To evaluate the preclinical safety of the PCV2 Cap mRNA-LNP vaccine candidates (with/without CpG ODN adjuvant), we conducted an acute toxicity assessment through single high-dose intraperitoneal administration in mice. Comprehensive analysis demonstrated excellent biocompatibility of both formulations. Serum biochemical parameters—including liver function markers (ALT and AST) and lipid metabolic profiles (TG, TC, HDL, and LDL)—remained within normal ranges and showed no significant differences compared to PBS controls (Fig. 4A). Histopathological examination revealed preserved tissue architecture without pathological alterations in all major organs (Fig. 4B and C). Collectively, these findings indicate an absence of hepatotoxicity or metabolic disruption induced by the mRNA-LNP platform and no enhanced toxicity risk with CpG ODN adjuvant incorporation. This study provides crucial experimental evidence for the translational potential of our PCV2 Cap mRNA-LNP vaccine platform.

In summary, this study provides robust preclinical proof-of-concept for a PCV2 Cap mRNA-LNP vaccine candidate. Our vaccine showed a favorable safety profile and superior immunogenicity. It elicited a balanced immune response with high-titer neutralizing antibodies and potent T-cell activity, outperforming conventional subunit vaccines. These results, together with the rapid development and manufacturing flexibility of the mRNA-LNP platform, support further evaluation of this candidate in pivotal swine challenge studies to definitively assess its protective efficacy against PCV2 infection.

The data that support the findings of this study are available from the corresponding author upon reasonable request.