Long noncoding RNA MALAT1 knockdown reverses chemoresistance to temozolomide via promoting microRNA‐101 in glioblastoma

The human GBM cell line U251 was purchased from Auragene Bioscience Inc., Changsha, China. The cells were cultured in Dulbecco's modified Eagle's medium (DMEM; Hyclone, USA) supplemented with 10% fetal bovine serum (FBS; Thermo Fisher, Waltham, MA), 100 U/mL penicillin, and 100 mg/mL streptomycin (Life Technologies, Carlsbad, CA). Cultures were maintained at 37°C in humidified air with 5% CO₂. TMZ (S1237) was purchased from Selleck Chemicals.

U251 cells (1 × 10⁵/mL) were exposed to an initial TMZ concentration of 1 μmol/L for 15 days. The surviving population of cells was grown to 80% confluence and passaged twice over 15–20 days. The concentration of TMZ was then sequentially increased in the same manner to 5 μmol/L (15 days), 25 μmol/L (15 days), 50 μmol/L (15 days), 100 μmol/L (20 days), 200 μmol/L (20 days), and finally to the concentration of 400 μmol/L (25 days) 20. The established TMZ‐resistant cell lines were designated as U251/TMZ.

Total RNA was extracted from frozen cells with the TRIzol reagent (Invitrogen, Shanghai, China), and the cDNA was synthesized using the Reverse Transcription Kit (Takara, China). The amount and quality of RNA were determined based on absorbance ratios with NanoDrop Lite (Thermo, USA). qRT‐PCR analyses were performed using SYBR Green qPCR Mix (TOYOBO, Osaka, Osaka Prefecture, Japan) according to the manufacturer's instructions. The expression levels of target genes were normalized to the transcription level of β‐actin. The data were collected and calculated using an ABI 7300 instrument (Life Tech). Primers for qRT‐PCR were synthesized by Invitrogen (Shanghai, China) and the sequences were: MALAT1 sense, 5′‐GACCCTTCACCCCTCACC‐3′ and antisense, 5′‐TTATGGATCATGCCCACAAG‐3′; miR‐101, HmiRQP0021; U6, HmiRQP9001; β‐actin sense, 5′‐AGGGGCCGGACTCGTCATACT‐3′; and antisense, 5′‐GGCGGCACCACCATGTACCCT‐3′.

The in situ hybridization (ISH) probe used for detecting MALAT1 was synthesized by Sangon Biotech (Shanghai, China). The probe sequence was designed as ACATTGCCTACCACTCTAAGA. Slices were processed using Enhanced Sensitive ISH Detection Kit I (Boster, Wuhan, Hubei, China) according to the manufacturer's instructions. Then, they were visualized with nitroblue tetrazolium chloride/5‐bromo‐4‐chloro‐3‐indolyl phosphate (Solarbio, Beijing, China) for 5 min and counterstained with nuclear fast red for 60 sec. And slides were photographed and quantitated with Olympus BX51 microscope (Olympus, Japan).

Proteins were extracted from cells with RIPA lysis buffer (Auragene Bioscience), which was supplemented with a protease inhibitor cocktail (Auragene Bioscience) and PMSF (Auragene Bioscience). Equal amounts (10 μg) of proteins were loaded on SDS‐PAGE and then were transferred to a PVDF Immobilon‐P membrane (Millipore, Billerica, MA). The membrane was blocked with 3% BSA‐TBST at room temperature for 90 min and continuously was probed with indicated primary antibodies at 4°C overnight. Then, the membranes were washed and incubated with specific secondary antibodies 1 h. A β‐actin antibody was used as a control, and the MRP1 (1:500; Abcam), P‐gp (1:400; Proteintech), MGMT (1:800; Abcam), cleaved‐PARP (1:800; Abcam), and GSK3β (1:1000; ImmunoWay) antibodies were used for each group.

The miR‐101 mimic (HmiR‐AN0021‐SN), miR‐101 inhibitor (HmiR‐AN0021‐SN‐10), and relative controls were purchased from GeneCopoeia Inc., Guangzhou, Guangdong, China. The transfection of mimic, inhibitor, and related controls was carried out using Lipo6000^™ (Beyotime, Nanjing, Jiangsu, China) according to the manufacturer's instructions. To suppress the expression of MALAT1, shMALAT1 sequence (target sequence: GACAGGTATCTCTTCGTTATC) was synthesized. The sequences were cloned into the BamHI and EcoRI sites of pGMLV‐SC5 with the forward oligo, gatccGACAGGTATCTCTTCGTTATCTTCAAGAGAGATAACGAAGAGATACCTGTCTTTTTTg and reverse oligo, aattcAAAAAAGACAGGTATCTCTTCGTTATCTCTCTTGAAGATAACGAAGAGATACCTGTCg. Lentiviral production, titration, and infection were performed as Li et al. described 21. Lentiviral plasmids pGMLV‐SC5 expressing shMALAT1 or control was cotransfected with the packaging vectors psPAX2 and pMD2.G into 293T cells using HG transgene reagent (Genomeditech, China). Lentiviral particles were harvested after 48 h of transfection. The U251/TMZ cells were then infected with lentiviruses and prepared for the further experiments. The expression of MALAT1 in cells was determined using qRT‐PCR.

The cell proliferation was assessed using 3‐(4,5‐dimethylthiazol‐2‐yl)‐2,5‐diphenyltetrazolium bromide (MTT) solution (Sangon Biotech). Forty‐eight hours after transfection, the GBM cells were seeded into 96‐well plates at an initial density of 5 × 10³ cells/well. After 24 h of culture, these cells were exposed to 50 μmol/L, 100 μmol/L, 200 μmol/L, 300 μmol/L, and 400 μmol/L TMZ for 24 h, respectively. Then, the cells were treated with 10 μL MTT by adding it to each well. The cells were incubated at 37°C with 5% CO₂ for another 4 h, then the medium was removed carefully, and 150 μL dimethyl sulfoxide (DMSO) solution (MP Biomedicals, USA) was added for 10 min to lyse the cells. Subsequently, the absorbance was measured at 570 nm using a microplate reader Multiskan MK (Thermo Scientific, Waltham, MA). The survival rate was calculated using the equation: (mean absorbance of drug well/mean absorbance of control wells) × 100%.

The GBM cells were placed into nine‐well plates and maintained in DMEM containing 10% FBS and 300 μmol/L TMZ. After 2–3 weeks, cells were fixed with 4% methanol and stained with GIMSA for 10–30 min. The visible colonies were manually counted, and the rate of colony formation was calculated with the following equation: (number of colonies/number of seeded cells) × 100%.

The apoptosis rate was assessed by flow cytometric analysis. The harvested GBM cells were washed twice with cold phosphate‐buffered saline (PBS). Then, these cells were fixed with cold 70% ethanol overnight and stained with 5 μL annexin V‐isothiocyanate (FITC) and 5 μL PI (Keygentec, Nanjing, Jiangsu, China) for 5–15 min in the dark at room temperature. The cells were then examined by flow cytometry (BD Biosciences, Franklin Lakes, NJ).

Apoptotic cells were identified using in situ cell death detection kit (Roche Applied Sciences, #1168479591; Penzberg, Upper Bavaria, Germany) according to the manufacturer's instructions. Nuclei were stained with DAPI. An inverted laser scanning confocal microscope at ×100 magnification (Zeiss, #710, Oberkochen, Baden Wurttemberg, Germany) was used for imaging, and ImageJ software was used for quantification of TUNEL‐positive cells.

Four‐week‐old male BALB/C‐NU mice were obtained from the Hunan SJA Laboratory Animals Center of the Chinese Academy of Sciences. The mice were housed under pathogen‐free conditions. To assess the tumor formation, the mice were injected with 2 × 10⁷/mL U251/TMZ cells subcutaneously. The weights of mice and tumor volumes were recorded every 3 days as the tumor reached 50–70 mm³. Tumor volume was calculated as follows: tumor volume = (width²×length)/2. At 25 days after U251/TMZ cells injection, it began to inject 5 mg/kg/day TMZ into the flank. After 35 days, the mice were killed, and the tumors derived from each group were used for comparison.

The fragments from MALAT1 containing the predicted miR‐101 binding site were synthesized and cloned into the luciferase construct psi‐CHECK2. The resulted vector MALAT1‐3′UTR‐psi‐CHECK2 was called the reporter vector MALAT1‐Wt. The corresponding mutant was called MALAT1‐Mut. The miR‐101 mimic or negative control miR‐NC was cotransfected with the reporter vectors using transfection reagent (Invitrogen, USA). Forty‐eight hours after transfection, firefly and renilla luciferase activities in cell lysates were measured using the Dual‐Luciferase Reporter Assay Kit (E1910; Promega, Madison, WI).

Error bars in figures represent SD (Standard Deviation), from at least three independent experiments. The paired t‐test was used for statistical analyses between groups, as appropriate. P <0.05 was considered to be statistically significant. Statistical analysis was performed with the GraphPad Prism 5.0 (GraphPad Software, San Diego, CA).

To explore the role of MALAT1 in TMZ resistance of glioma cells, we first established TMZ‐resistant GBM cell line U251 as described in Materials and Methods. As shown in Figure 1A, the cell survival rate of TMZ‐resistant cell line U251/TMZ and the parental cell line declined in a TMZ (0‐400 μmol/L) dose‐dependent manner, and U251/TMZ showed significantly improved resistance to TMZ compared with the parental cell lines. The half maximal inhibitory concentration (IC50) values of TMZ in U251 and U251/TMZ were (57.63 ± 2.1) μmol/L and (348.8 ± 34.32) μmol/L, respectively (Fig. 1B). In addition, we examined the expressions of chemoresistance‐related genes in these GBM cell lines, including multidrug resistance‐associated protein 1 (MRP1), O⁶‐methylguanine‐DNA methyltransferase (MGMT), and P‐glycoprotein (P‐gp). The U251/TMZ showed elevated expressions of these chemoresistance‐related genes, suggesting that changes of gene regulation network were involved in the TMZ resistance of U251/TMZ (Fig. 1C). Subsequently, we sought to determine whether MALAT1 was dysregulated in TMZ‐resistant cell line U251/TMZ. To address this question, we examined the mRNA expressions of MALAT1 in cell lines U251/TMZ and U251 using qRT‐PCR (Fig. 1D). The expression of MALAT1 increased significantly in U‐251/TMZ compared with the parental cell. Moreover, the ISH assay also indicated a high expression of MALAT1 correlates with TMZ resistance in GBM cells (Fig. 1E). And the results were supported by the study using GBM cell line U87 as well (Fig. S1).

As MALAT1 were highly upregulated in TMZ‐resistant GBM cell line U251/TMZ, we used MALAT1 knockdown GBM cell line U251/TMZ‐shMALAT1 to explore the role of MALAT1 played in TMZ resistance. The efficiency of MALAT1 knockdown was examined by qRT‐PCR analysis. The expression of MALAT1 in the U251/TMZ‐shMALAT1 was significantly suppressed as compared with the control group (Fig. 2A). To investigate whether the knockdown of MALAT1 in U251/TMZ‐shMALAT1 could influence the TMZ resistance, MTT assay was performed. We found the knockdown group U251/TMZ‐shMALAT1 showed decreased resistance to TMZ compared with control group (Fig. 2B). Besides, we performed colony formation assay. In the absence of TMZ, the U251/TMZ‐shMALAT1 showed a decreased rate of colony formation. In the presence of TMZ, knockdown of MALAT1 sensitized U251/TMZ cells to the treatment, as indicated by the significantly decreased rate of colony formation (Fig. 2C). To further determine whether decreased TMZ resistance of GBM reflected cell apoptosis, the flow cytometry assays and TUNEL assay were performed. The results showed that both TMZ‐treated or nontreated U251/TMZ‐shMALAT1 had higher apoptotic rates in comparison with the control group, and the apoptosis rate of shMALAT1 group was significantly increased with the treatment of TMZ (Fig. 2D and E). To evaluate the effect of MALAT1 in TMZ resistance in vivo, the U251/TMZ‐shMALAT1 or U251/TMZ‐shNC cells were injected into flanks of nude mice. Consistent with the in vitro results, tumor growth in the shMALAT1 group was significantly attenuated compared to the control group (Fig. 2F). Following the TMZ treatment began at 25th day after injection, knockdown of MALAT1 reduced the TMZ resistance of shMALAT1 group. Moreover, after tumors were harvested, both the tumor volume and weight in shMALAT1 group were significantly reduced compared to the control group. And the results were supported by the study using GBM cell line U87 as well (Fig. S2). Taken together, our results indicated that low expression of MALAT1 reversed chemoresistance in TMZ‐resistant GBM cells both in vitro and in vivo (Fig. 2G).

To further investigate the potential regulatory mechanism of MALAT1 in TMZ resistance, we performed in silico analysis to identify putative interacting microRNA based on the online database microRNA.org (http://www.microRNA.org↗). The miR‐101 was predicted to be one of the potential interacting genes of MALAT1 (Fig. 3A). miR‐101 was found involved in sensitizing tumor to radiation and significantly downregulated in GBM cells 22. To determine whether MALAT1 is a direct target gene of miR‐101, the luciferase reporter assay was performed. These psi‐CHECK2 constructs containing putative binding site or the mutant one were cotransduced with miR‐101 mimics or miRNA NC (negative control). As shown in Figure 3B, miR‐101 repressed the luciferase activity of wild‐type MALAT1, but not that of the mutant, indicating a direct binding between MALAT1 and miR‐101. Furthermore, we assessed the expression of miR‐101 and MALAT1 in MALAT1 knockdown and miR‐101 overexpression U251 cells. Knockdown of MALAT1 significantly promoted the expression of miR‐101 in U251 cells and overexpression of miR‐101 decreased the MALAT1 expression (Fig. 3C and D). Collectively, these results indicated that MALAT1 was a direct target of miR‐101.

To evaluate the potential role of miR‐101 in TMZ resistance, we first compared the expression of miR‐101 in U‐251/TMZ with that in its parental cell. It was shown that expression of miR‐101 largely decreased in U‐251/TMZ compared with the parental cell, suggesting high expression of miR‐101 correlated with TMZ resistance in GBM cells (Fig. 4A). Then, we overexpressed miR‐101 in TMZ‐resistant U251/TMZ cells. As shown in Figure 4B, miR‐101 in the U251/TMZ‐miR‐101 group was significantly upregulated as compared with control group. Subsequently, MTT assay was used to investigate whether overexpression of miR‐101 in U251/TMZ could influence the TMZ resistance. The U251/TMZ cells transduced with miR‐101 mimics exhibited decreased cell survival rates under TMZ treatments in comparison with the control (Fig. 4C). In addition, as indicated by colony formation assay, the high expression of miR‐101 attenuated the colony formation of TMZ‐resistant U251/TMZ cells, especially under TMZ treatment (Fig. 4D). Moreover, by flow cytometry assay and TUNEL assay, we found that the miR‐101 overexpression had a similar effect as the MALAT1 knockdown, which intensified the promotion of apoptosis rate of U251/TMZ under the treatment of TMZ in comparison with that one in the absence of TMZ treatment (Fig. 4E and F). And the results were supported by the study using GBM cell line U87 as well (Fig. S3). Taken together, these results suggest that miR‐101 and MALAT1 play antagonistic roles in regulation of TMZ resistance in GBM cells.

As there was a direct binding between MALAT1 and miR‐101, and they played antagonistic roles in TMZ resistance, we hypothesized that MALAT1 promotes TMZ chemoresistance thorough suppressing miR‐101. To validate this hypothesis, the U251/TMZ cell lines were cotransfected with MALAT1 knockdown vector and the miR‐101 mimics or miR‐101 inhibitors. As Figure 5A indicated, the combination of MALAT1 knockdown and miR‐101 overexpression largely reduced the chemoresistance to TMZ (50–400 μmol/L). Moreover, the inhibition of TMZ resistance caused by MALAT1 knockdown was reversed by knockdown of miR‐101. Besides, colony formation assay was performed in these cotransfection groups. The combination of MALAT1 knockdown and miR‐101 overexpression caused the lowest rate of colony formation (10.53 ± 1.55%) in all cotransfection groups when were treated with 300 μmol/L TMZ (Fig. 5B). In contrast, the reduction in colony formation mediated by knockdown of MALAT1 was attenuated by miR‐101 knockdown. Furthermore, as indicated by flow cytometry assay, overexpression of miR‐101 combining with knockdown of MALAT1 greatly promoted the apoptosis rate of U251/TMZ (Fig. 5C). However, knockdown of miR‐101 weakened the effect of shMALAT1 on apoptosis of U251/TMZ. In addition, we investigated the expressions of cleaved‐PARP and cleaved‐Caspase9, which were well‐known apoptosis markers 23. As shown in Figure 5D, expressions of cleaved‐PARP and cleaved‐Caspase9 were significantly elevated by the combination of MALAT1 knockdown and miR‐101 overexpression. On the contrary, the knockdown of miR‐101 attenuated the upregulations of cleaved‐PARP and cleaved‐Caspase9, which were caused by knockdown of MALAT1 in U251/TMZ. Thus, we concluded that MALAT1 inhibition reversed TMZ resistance through suppressing colony formation and promoting apoptosis by upregulating miR‐101.

Previously, it was reported that miR‐101 sensitized resistant GBM cells to TMZ through downregulation of GSK3β, which is a multifunctional protein kinase that regulates various cellular pathways 19. Moreover, inhibition of GSK3β could enhance TMZ effect by decreasing O⁶‐methylguanine‐DNA methyltransferase (MGMT) expression via promoter methylation 24. To further investigate whether MALAT1 knockdown decreased TMZ resistance of GBM cells through promoting miR‐101 regulatory network, we performed the Western blotting in these transgenic lines. As shown in Figure 6A, the endogenous protein level of GSK3β and MGMT was significantly suppressed by combination of MALAT1 knockdown and miR‐101 overexpression. However, the suppressions of GSK3β and MGMT were weakened by knockdown of miR‐101. To further assess whether the suppression of MGMT was caused by the promoter methylation, we performed the bisulfite sequencing PCR (BSP) assay (Fig. 6B). The promoter methylation of MGMT was largely promoted by the combination of MALAT1 knockdown and miR‐101 overexpression, and on the contrary, knockdown of miR‐101 attenuated the upregulation of promoter methylation, which was mainly caused by knockdown of MALAT1. Taken together, these results showed that knockdown of MALAT1 could suppress the expression of GSK3β and MGMT by upregulating miR‐101, and these results further suggested that the influences of MALAT1 knockdown on TMZ resistance were associated with miR‐101 regulatory network.