OPN silencing reduces hypoxic pulmonary hypertension via PI3K-AKT-induced protective autophagy

The DEGs were analyzed using the "limma" package²¹ in the R software (version 4.2.2.) Specifically, this study used the Imfit function to find multiple linear regressions on the dataset. Then, we used the eBays function to compute the regulation t-statistic, the regulation F-statistic, and the log odds of differential expression by empirical Bayesian adjustment of the standard error to the common value. Finally, we obtained the significance of the difference for each gene. We set the fold change to log Fold Change > 1 and adjusted the p-value to set it to less than 0.01 to screen for target genes. Differential genes were then visualized using the "ggplot2" and "heatmap" R packages for volcano maps of all differential genes and heatmaps of the top 50 differentially up-and-down-regulated genes.

WGCNA is an algorithm that evaluates the relationships between measured transcripts, identifies clinically relevant co-expressed gene modules, and explores key genes in disease pathways from a systems biology perspective²². The “WGCNA” R package was used to construct the PAH correlation module. To implement the scale-free network, the "pickSoftThreshold" function in the package was used to determine the optimal soft-threshold power β for increasing the expression similarity and calculating the neighboring relationships. Next, the gene correlation matrix was transformed into a neighboring matrix, which was further converted into an unsigned topological overlap matrix (TOM). According to the TOM, average chained hierarchical clustering was used to obtain gene clusters and construct a dendrogram. A minimum module size of 30 genes was used to identify gene modules using a dynamic tree-cutting algorithm (deep Split = 2); genes with similar expression patterns were assigned to the same module. Module-characterized genes (MEs) were calculated as the first principal component of the expression profile in each module. Modules were then clustered and merged based on ME differences (merge Cut Height = 0.25). The correlation between MEs and clinical characteristics of PAH patients was calculated using the Pearson correlation coefficient. Then, the two modules with the highest coefficients were targeted and the genes within the two modules were extracted for further analysis.

Genes enriched in blue and turquoise modules with gene significance greater than 0.5 in WGCNA were analyzed by Gene Ontology (GO) annotation and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analysis^23–25 using the "cluster Profiler" R (version 4.2.2) package²⁶, including biological process (BP), cellular component (CC), molecular function (MF) and KEGG pathway enrichment analysis visualized by the "ggplot2" R package. BP, CC, MF, and KEGG pathway enrichment analyses were included and visualized by the "ggplot2" R package. The P-value was set to 0.05 as the critical value.

We used the "Veen" R (version 4.2.2) package to identify DEGs, differential module genes, and ARGs co-expressed in DEMARGs. Subsequently, protein–protein interaction (PPI) between DEMARGs was analyzed and visualized by the CYTOSCAPE (version 3.9.1) software using the Searching for Gene Interactions Search Tool (STRING) database (https://cn.string-db.org↗ (accessed December 18, 2022)) to analyze PPI between DEMARGs and visualize them by CYTOSCAPE (version 3.9.1) software²⁷. The DEMARGs were ranked using four algorithms, MCC, MNC, Degree, and EPC²⁸ in the CytoHubba plugin to obtain the top ten Hub genes, and the Hub genes were analyzed for KEGG enrichment.

GeneMANIA (http://www.genemania.org↗ (accessed February 18, 2023)) provides a flexible, user-friendly analysis web interface for generating hypotheses based on gene function, analyzing gene lists, and prioritizing genes for functional analysis²⁹. GeneMANIA was used to construct the gene–gene interaction network of Hub genes from physical interactions, co-expression, prediction, co-localization, and genetic interactions, and to evaluate their functions.

C57BL/6J (wide-type) mice were used as background. Transgelin protein encoded by the transgelin (TAGLN) gene is involved in regulating the formation and maintenance of the cytoskeleton, influencing cell contraction, morphology, and migration, and is an early marker of smooth muscle differentiation. To construct the targeting vector, BAC clone RP24-190A7 was used as a template to generate homologous Bo and cKO regions by PCR. Cas9 protein, sgRNA and targeting vector were co-injected into mouse fertilized eggs to generate F0 mice. F0-positive mice were mated with WT (TAGLN-Cre-containing) mice to obtain F1 generation OPN^flox/+, TAGLN-Cre heterozygous mice that can be stably inherited. F1 generation OPN^flox/−, TAGLN-Cre mice were self-crossed with mice of the same genotype to obtain pure and OPN^flox/flox, TAGLN-Cre mice as vascular smooth muscle-specific knockout mice for experiments. Controls were littermate control OPN^flox/flox mice (10–12 weeks) weighing 22 to 25 g for this study. All mice were purchased from Cyagen Biological Research Center (Taicang, China) (license SCXK (Su) 2018–0003). They were housed in a temperature-controlled environment at 22 ± 2 °C with a relative humidity of 45–55% and were fed ad libitum with a standard laboratory diet and tap water for 1 week before the experiment. The animals were randomly divided into 4 groups: (1) normoxic control using OPN^flox/flox control mice (n = 7, hereafter referred to as normoxia group); (2) normoxic using OPN^flox/flox, TAGLN-Cre mice (n = 7, hereafter referred to as normoxia + OPN^fl/fl-TAGLN-Cre group); (3) hypoxic environment using OPN^flox/flox control mice (n = 7, hereafter referred to as hypoxia group); (4) using OPN^flox/flox, TAGLN-Cre mice in a hypoxic environment (n = 7, hereafter referred to as hypoxia + OPN^fl/fl-TAGLN-Cre group). 3 and 4 groups were housed in a DYC3000 low-pressure hypoxic (10.6% oxygen content relative to sea level) chamber (Fenglei, Guizhou, China) at a simulated altitude of 5000 m for 28 days, and all animals were kept in a 12-h light-12-h dark cycle at 22 ± 2 °C, with food provided ad libitum, and bedding changed every 3 days.

A 2% sodium pentobarbital anesthetic was injected into the peritoneal cavity of mice according to their body weight. When the mice were in deep anesthesia, the mice were placed supine and fixed on the mouse platform, and a cut was made in the middle of the anterior neck to locate and separate the right measured external jugular vein, and a polyethylene microcatheter was heparinized and inserted from the right external jugular vein to the pulmonary artery. The other end was connected to a BL-420S biopressure transducer (Ed Instruments, Shanghai, China), and the pulmonary artery pressure profile was recorded for 5 min.

Immediately after the dislocation and execution of mice under anesthesia, heart, and lung tissues were removed, the surface was cleaned of blood with saline, and the whole heart was weighed, the right ventricle (RV) was cut out and the RV was weighed, followed by isolation of the left ventricle (LV) and the interventricular septum (S), and weighing the LV and the S. The right ventricle was then removed from the right ventricle and the septum was removed from the right ventricle. The result of calculating the Fulton index (RV/LV + S) represented the right ventricular hypertrophy index (RVHI).

Pulmonary arteries and PASMCs from all groups were fixed by adding 3% glutaraldehyde fixative at 4 °C for 24 h, and 1% osmium tetroxide was added and fixed for another 2 h. The fixed samples were dehydrated stepwise by immersing them in acetone and then embedded in epoxy resin after completion of dehydration. The samples were prepared into 50 nm sections, and the sections were stained with lead citrate and placed under a JEM-1400FLASH transmission electron microscope (JEOL, Tokyo, Japan) for observation and image acquisition.

Ten 6-week-old SD rats (Certificate of Conformity No. 110322220100347884) purchased from Beijing Huafu Biotechnology Company were euthanized by cervical dislocation after being anesthetized by intraperitoneal injection of 2% sodium pentobarbital and were sterilized in 75% ethanol for 3 min. The heart and lung tissues were taken out by opening the thoracic cavity in an ultra-clean bench and placed in Petri dishes containing pre-cooled sterile 1% PBS at 4 °C (Solepol, Beijing, China)) in a Petri dish. The heart was removed, and the lung tissue was washed with PBS, and the lung tissue was fixed in a Petri dish containing floatation. Secondary and tertiary pulmonary arteries were isolated step by step down the main pulmonary artery trunk. They were transferred to a new petri dish for cleaning and then the small pulmonary arteries were cut longitudinally, the endothelial cells were gently scraped with a scalpel, and the outer and middle membranes were separated with ophthalmic forceps. The middle smooth muscle tissue was cut into 1 mm³-sized tissue blocks, which were then transferred to 15 mL centrifuge tubes containing 1–2 mL of 0.2% type II collagenase (Solebol, Beijing, China), and the centrifuge tubes were placed in a water bath at 37 °C for digestion for about 1 h. Digestion was terminated when the tissue blocks became flocculent. After digestion, the cells were resuspended in high glucose DMEM medium (Procell, Wuhan, China) containing 20% FBS (Gibco, California, USA), and the resuspension solution was added into the culture flasks and placed in a humidified incubator at 37 with 5% CO₂ (Thermo HERAcell150i, Thermo Fisher Scientific, America) for culture. When the cells grew to about 70% confluence, the cells were purified by differential wall affixation. Generation 3–5 cells were used for subsequent experimental studies. In addition, the cells were classified into normoxia, hypoxia, hypoxia + OPN shRNA EV, hypoxia + OPN shRNA, and hypoxia + LY294002 (PI3K inhibitor) groups. Normoxic PASMCs were placed in an ambient incubator (Thermo HERAcell 150i, ThermoFisher, USA) with 5% CO₂ and 20% O₂ for 48 h, and hypoxic PASMCs were placed in an ambient incubator (CB53, BINDER, Germany) with 5% CO₂ and 1% O₂ for 48 h and then used for subsequent cell experiments.

Logarithmic growth phase PASMCs were digested with 0.2% trypsin (Solebol, Beijing, China), and 1 × 10⁴ cells were inoculated into 6-well cell culture plates. After cell attachment, the original medium was discarded, the cells were washed twice with PBS, and 4% paraformaldehyde was added to fix the cells at room temperature for 15 min. The cells were subsequently processed according to the steps of the two-step immunohistochemistry kit (Elabscience, Wuhan, China). Used to identify PASMCs, brown cells represent PASMCs.

Total RNA from lung tissues was extracted using the Total RNA Extraction Kit (TIANGEN, Beijing, China) according to the manufacturer's instructions. cDNA was synthesized using the Reverse Transcription Reagent (TIANGEN, Beijing, China). cDNA was extracted from lung tissues using SuperReal PreMix Color (SYBR Green) (TIANGEN, Beijing, China) to determine the gene expression levels in an ABI PRISM 7500 sequence detection system (Applied Biosystems, Foster City, USA). Transcript expression levels were normalized to endogenous β-actin expression levels. All primer sequences were shown in Supplementary Table. 1

OPN interference sequences were designed, forward ‘GATGTCCCTFACGGCCGAGGT’, reverse ‘ACCTCGGCCGTCAGGGGACATC’. Logarithmic growth phase PASMCs were inoculated in 25 mm² culture flasks according to the instructions of the company from which they were purchased (Cyagen, California, America), and the cells were transfected with OPN interference sequences when the cells had grown to 30–40%. The virus was first lysed in a disease bath, polybrene was added to the virus-containing medium, and the viral solution was allowed to cover the surface of all cells overnight, and the virus-containing medium was removed the day after transfection to add fresh complete medium. After the virus-containing cells stably expressed specific green fluorescence, the cells were collected for subsequent experiments. The PASMCs were categorized into the hypoxia + OPN shRNA EV group plus containing OPN empty virus; and hypoxia + OPN shRNA group plus containing OPN interfering with lentivirus.

Lung tissues and cells of each group were collected, and the supernatant was collected after lysis on ice by adding the appropriate amount of RIPA lysate. Protein concentration was detected by the BCA (No. 23227, Thermo Fisher Scientific) method. Polyacrylamide gel electrophoresis (SDS-PAGE) was performed with 30 µg of protein per well, and the target proteins were transfected onto a PVDF membrane, which was closed with 5% skimmed milk powder at room temperature for 1 h. To reduce the number of primary antibodies used, we cut the membranes to the appropriate size based on the marker corresponding to the molecular weight of the protein before incubating the membranes with the following primary antibody. The membranes were incubated with LC3B (1:1000, No. ab192890, Abcam), Beclin1 (1:2000, No. ab207612, Abcam), OPN (1:1000, No. ab63856, Abcam), PI3K (1:2000, No. ab191606, Abcam), AKT (1:1000, No. ab8805, Abcam), β-actin (1:5000, No. AC026, ABclonal) antibodies were incubated overnight at 4 °C in the refrigerator. The membrane was washed three times with TBST on the following day and then added with anti-mouse HRP secondary antibody (1:10,000, No. AS003, ABclonal) or anti-rabbit HRP secondary antibody (1:10,000, No. AS014, ABclonal) and incubated at room temperature for 1 h. After washing, the membrane was washed with ultrasensitive luminescent solution (No. 1856189, Thermo Fisher Scientific, America) in a gel imager to develop and save the images and analyze the gray value of the bands with ImageJ software (version 1.53t) to calculate the relative protein expression with β-actin as an internal reference.

EdU staining was performed using the BeyoClick™ EdU Cell Proliferation Detection Kit (BeyoClick, Nanjing, China). Cells were inoculated in 6-well plates and stained with 50 μM EdU for 2 h. Subsequently, cells were washed twice with PBS, fixed with 50 μL of fixative (PBS + 4% polyoxymethylene), and incubated for 30 min. Finally, cells were discolored with 100 μL of permeabilization agent (PBS + 0.5% TritonX-100) for 2–3 times (each rinse for 10 min). the nuclei were stained with DAPI staining of nuclei was performed for 10 min. Cell staining results were observed with an inverted fluorescence microscope and EdU positively stained cells were counted using ImageJ software (version 1.53t).

PASMCs were inoculated in 6-well plates at 8 × 10⁴ cells/well. PASMCs were grown in normoxia, hypoxia, hypoxia empty virus, hypoxia OPN shRNA, and hypoxia LY294002 culture environments. The normal untreated normoxia group served as a control. Cells were treated with a cell cycle assay kit (cell cycle assay kit, E-CK-A351, Wuhan, China). 48 h later, PASMCs were cultured in a conditioned medium collected in 1.5 mL centrifuge tubes, and the cells were washed with precooled PBS, and fixed in pre-cooled anhydrous ethanol at − 20 °C for 1 h. After washing again with PBS, 100 μL of RNase A Regent in a water bath at 37 °C for 0.5 h. After washing again with PBS, 25 μL of PI Regent was added, gently mixed, resuspended, and incubated for 30 min at 37 °C, protected from light, before being detected by flow cytometry to detect changes in the cell cycle. The data were further analyzed using FlowJo software (version 10.8.1).

Statistical analyses were performed using R software (version 4.2.2) or GraphPad Prism (version 9). All data are expressed as mean ± standard deviation (SD) and all experiments were repeated at least 3 times. Significant differences were determined using Bonferroni’s multiple comparison test with a one-way analysis of variance (ANOVA) between the control and other groups. p < 0.05 was considered statistically significant.

This study conformed to the stipulations set forth in the ARRIVE guidelines for experimental animals research. The protocols governing animal care and experimental utilization were rigorously aligned with the Chinese Guidelines for the Care and Use of Laboratory Animals. The animal experiments obtained approval from the Ethics Committee of Qinghai University School of Medicine.

Supplementary Information.