Time‐of‐Day Defines the Risk of Thermally Abused Frying Oil to Renal Injury by Modulating the Diurnal Dynamics of Oxylipins

We investigated the effects of thermally induced oxidized oil intake and feeding time on renal injury in mice. Although fried oil had no effect on kidney injury in chow diet‐treated mice (Figure S1A,B), histological examination of mice treated with oxidized oil revealed severe renal injury after ad libitum feeding of a high‐fat diet containing fried oil (FO, thermo‐induced oxidized oil), as indicated by remarkable tubular injury and swelling (Figure S2A,B). The oxidized oil also increased the levels of blood urea nitrogen (BUN, Figure S2C) and creatinine (Figure S2D), without affecting body weight or food intake. In addition, Masson's trichrome staining showed a slight increase in fibrotic areas in the kidneys of oxidized oil‐treated mice (Figure S2E), indicating that renal dysfunction and fibrosis induced by dietary thermally induced oxidized oil. To assess renal function in mice with a timed intake of oxidized oil (Figure S2A and Figure 1A), we tested two different timed feeding pattern protocols (light‐restricted feeding and 12‐h active/12‐h inactive feeding). Time‐restricted feeding of oxidized oil during the inactive period promoted kidney injury in mice, as indicated by vacuolar degeneration, glomerular hypertrophy, and tubular lumen expansion in renal tissue (Figure S2B) and elevated serum BUN and creatinine levels (Figures S2C,D). Likewise, as for the mice with access to HFD containing oxidized oil (Figure 1A) during light‐phase (LFO) and HFD during dark‐phase (DFO), these mice show exacerbated pathological renal damage and glomerular fibrosis in mice (Figures 1B–D), with significantly increased BUN, creatinine, and urine albumin‐creatinine ratio (UACR) (Figures 1E,F and Figure S3A), confirming that timed feeding of oxidized oil during the daytime leads to aggravated renal dysfunction. By contrast, micefed an HFD containing oxidized oil during the dark phase (DFO) did not show significant changes in renal dysfunction. Consistent with these pathological changes, timed feeding of oxidized oil during the light/inactive period increased renal α‐smooth muscle actin (α‐SMA) and E‐cadherin (Figures 1G–I and Figure S3A,B) and serum KIM‐1 (kidney injury molecule 1) and NGAL (neutrophil gelatinase‐associated lipocalin) levels (Figure S4B,C), indicating marked activation of the fibrogenic pathway during timed feeding of oxidized oil in the inactive period.

We compared the ultra‐high‐performance liquid chromatography‐mass spectrometry (UPLC‐MS/MS) oxylipin profile signatures in the kidneys of mice with access to oxidized oil during the light phase (inactive) versus the dark phase (active). Oxygenated polyunsaturated fatty acids (oxylipins) are essential bioactive lipid mediators derived from arachidonic acid (AA), linoleic acid (LA), and other polyunsaturated fatty acids (PUFAs). Twenty‐seven oxylipin metabolites were detected and their changes in these mice are shown in a normalized heatmap (Figure 2A). The renal oxylipidome was affected in mice treated with LFO (access to oxidized oil in the light phase) but not in DFO‐treated mice (access to oxidized oil in the dark phase). Cytochrome P450 (CYP450) epoxygenases can utilize arachidonic acid (AA) and linoleic acid (LA) as substrates to produce endogenous epoxides or other oxylipins, which are subsequently hydrolyzed by epoxide hydrolases (EHs, including microsomal epoxide hydrolase and soluble epoxide hydrolase) to dihydroxyeicosatrienoic acids (DHETs) or DiHOME, the diol form of epoxides (Figure 2B). Notably, we plotted fold changes in oxylipins levels and identified reduced levels of 9,10‐epoxyoctadecenoic (EpOME) and several epoxyeicosatrienoic acids (EETs, including 11,12‐EET and 14,15‐EET) along with increased levels of 9,10‐DiHOME and several dihydroxyeicosatrienoic acids (14,15‐DHET and 8,9‐DHET) in the kidneys of LFO‐fed mice (Figure 2C). These changes were only observed between control and LFO‐fed mice. The imbalance between the epoxides and their corresponding diols was associated with increased mRNA and protein expression of genes encoding EHs (Ephx1 and Ephx2) in the kidneys of LFO‐fed mice, as reflected by Figure 2D,E,G, and Figure S5, which are involved in the conversion of bioactive epoxides to less active diols. In addition, feeding oxidized oil during the light phase failed to modify the cytochrome P450 monooxygenase eicosanoid pathway (Cyp2c29, Cyp2c44, Cyp2j2, Cyp2j5, Cyp2j9, Cyp2c8, Cyp2c9, Cyp4a12a, Cyp4a12b, Cyp4f16, and Cyp4f13), the predominant epoxygenase isoforms involved in EETs formation, except for Cyp2c37 (Figure 2F). These results suggested that timed feeding of oxidized oil during the inactive period worsens oxylipins metabolism in the kidney via the activation of epoxide hydrolase.

Currently, palm oil and vegetable oil with high oleic acid contents are the preferred choices for deep frying and are widely used in commercial restaurants [15, 16]. The safety of fried food is controlled by the chemical structural changes and oxidation of the frying oil [17, 18]. Our research group and others have reported that epoxy‐fatty acids (EpFAs) in fried oils, ranging from 0.3 to 5.9%, are the main group of oxidized and polar lipids [19]. During the deep frying of palm oil and high oleic acid oil, we found that epoxy stearic acid (EpSA, 9,10‐epoxy stearic acid) derived from oleic acid during thermal oxidation is the main form of EpFAs. The presence of EpFAs in oxidized edible oils is thought to be a hazardous lipid oxidation products [20], and several studies have suggested the potential health risks associated with consuming epoxy fatty acids in the diet [21, 22]. In our study, through in vivo EHs activity assessment, we found that 9,10‐EpSA in oxidized edible oils activated EH activity in TCMK‐1 cells treated with high glucose (Figure S6A). In addition, 9,10‐EpSA increased the protein levels of Ephx1 (gene encodes for microsomal epoxide hydrolase, mEH) and Ephx2 (gene encodes for soluble epoxide hydrolase, sEHs) in TCMK‐1 tubular epithelial cells, the tubular epithelial cells (Figures S6B,C), suggesting that 9,10‐EpSA in oxidized edible oils is involved in the regulation of oxylipins metabolism. We hypothesized that renal injury induced by timed feeding of oxidized edible oils may be related to the loss of the circadian rhythmicity in oxylipin metabolism.

To understand the molecular basis underlying the loss of circadian rhythmicity with timed feeding of EpSA from oxidized oil, we initiated transcriptomics analysis and assessed the diurnal rhythms of kidneys from mice collected at 4‐h intervals over 24 h. Mice were fed with HFD during the dark phase or accessed with HFD containing EpSAs during the light phase (Figure 3A). As expected, renal transcriptome analysis by RNA sequencing and rhythmic analysis using MetaCycle identified a total of 282 dark/inactive and 982 light/active in‐phase circadian transcripts. When mice were fed EpSA during the light phase, these 982 light in‐phase circadian transcripts were reduced to 533 transcripts, with 55 common to both conditions (Figure 3B). However, the number of dark in‐phase circadian transcripts increased slightly to 328 transcripts when fed with EpSA during the light‐phase. In addition, 29 transcripts were not classified as day‐ or night‐in‐phase circadian transcripts in either group. Disruption of circadian rhythmicity during timed feeding of EpSA was observed for both day‐ and night‐peaking transcripts, with the majority of transcripts showing a loss of rhythmicity (Figure 3B–D) and a significant reduction in circadian amplitude of expression (Figure 3D), as indicated by the JTK_CYCLE results of diurnally oscillating transcripts. Furthermore, we identified the rhythmicity of four genes (including Ephx1, Ephx2, Ephx3, and Ephx4) encoding epoxide hydrolases. Consistent with the findings of previous studies [23, 24], the expression profiles of epoxide hydrolase transcripts oscillated in a circadian manner and appeared to be clearly circadian in control mice (e.g., Ephx1 and Ephx2; Figure 3E). The rhythmic oscillations of Ephx1 and Ephx2 at the protein level in the control group were similar to the circadian rhythmicity of transcripts (Figure 3F). Notably, the phase distribution of Ephx1 and Ephx2 peaked around ZT17 and ZT20, respectively, whereas Ephx1 and Ephx2 were inhibited by the circadian clock during the light/inactive phase. However, we observed that timed feeding of EpSA completely disrupted the phase of epoxide hydrolases‐coding genes in the kidney (Figure 3E). In particular, the inhibition of Ephx1 and Ephx2 during the light/inactive phase was disrupted by timed feeding of EpSA in this phase.

To match our findings on diurnal transcriptomes, we assessed diurnal lipidomes and diurnal oxylipins using targeted lipidomics of oxylipins and untargeted lipidomics (Figure 4A,B) of the kidney and plasma. The percentage of rhythmic lipids in all lipid classes was approximately 24.3% in the renal lipidome. Timed feeding of EpSA specifically reprogrammed the lipidome of the renal samples, as indicated by principal component analysis (PCA) and heatmap visualization of diurnally oscillating transcripts (Figures S7 and S8). Regarding specific lipid classes, the oxylipins class (37.0%) was one of the most rhythmic lipid classes in the kidneys of mice (Figures 4B and 5A). Subsequently, we identified rhythmic oxylipin metabolites in the plasma and kidney computed by CircaCompare. As expected, several epoxides and their corresponding diols exhibited pronounced circadian variations in the mouse kidneys and plasma (Figures 4C–Q and 5D–R; Figure S9). In the kidney, 8,9‐EET, 11,12‐EET, and 14,15‐EET formation are rhythmic (Figure 4C–E) with the zenith reached around the phase of ZT5 (light phase), whereas the corresponding 8,9‐DHET and 11,12‐DHET formation also exhibited rhythmicity with a 24‐h period (Figure 4H–J). However, 14,15‐DHET showed less rhythmicity in the kidneys. Both 9,10‐EpOME and 12,13‐EpOME exhibited rhythmic variations with zenith levels around ZT6.1 and ZT3.7 (light phase) respectively (Figure 4F,G) and exhibited nadir levels around ZT13 (early of dark phase), whereas 9,10‐DiHOME showed only slight circadian variations (Figure 4K,L). Certain oxylipins, such as multiple types of EETs (including 8,9‐EET, 14,15‐EET), prostaglandins, thromboxane (TX)‐A2, and leukotrienes, exhibit a rhythmic patterns, with their production or concentration significantly changing at different times of the day in the plasma, brain, urine, and vasculature [24, 25, 26, 27]. Consistent with the findings of previous studies, the total EETs and EpOMEs formation in the kidney and plasma showed a significant day‐night rhythm in amplitude across 24 h (Figures S9A and S9B; Figure 5B,C), peaking during the light/inactive phase.

Based on the previous data, we hypothesized that the observed alteration in oxylipin metabolism in the kidneys of timed‐fed oxidized oil might be due to transcriptional oscillations of epoxide hydrolase genes induced by EpSA. Indeed, the timed feeding of EpSA during the light phase, but not the dark phase, selectively dampened the oscillation of rhythmic EETs and EpOMEs abundance in the kidney while increasing the oscillation of respective diols (DHETs and DiHOME) abundance in the kidney (Figure 4C–Q). We speculated that the balance between EETs/EpOME and DHET/DiHOME generation in the kidney may be due to the rhythmic expression of epoxide hydrolase genes. EETs and EpOMEs could be hydrolyzed to DHETs and DiHOME, respectively, by epoxide hydrolase. Interestingly, previous studies have shown that reduced EET levels contribute to kidney inflammation, fibrosis, and loss of renal function [28]. By contrast, DHETs play opposing roles in the regulation of renal function [28]. In the control group, except for the renal 9,10‐DiHOME/EpOME ratio, the ratios of 8,9‐DHET/EET, 11,12‐DHET/EET, 14,15‐DHET/EET, and 12,13‐DiHOME/EpOME were found to be rhythmically up‐ and downregulated over a 24‐h period in a diurnal fashion (Figure 4N–Q). However, the rhythmic ratio of DHET/EET in the kidney peaked at different times in the control, DFO, and LFO mice. The rhythmic DHET/EET ratio peaked almost exclusively during the light phase in the kidneys of mice with timed feeding of EpSA during the light phase, with the exception of the 12,13‐DiHOME/EpOME ratio peaking towards the middle of the dark phase. In addition, timed feeding of EpSA reduced the total EETs and total EpOMEs levels (Figure S6), and elevated the peak levels of diols and the diols/epoxides ratio in the kidney and plasma (Figures 4N–Q, and 5N–R). These data support the novel hypothesis that rhythmic disruption of epoxide hydrolase genes results in rhythmic variations in the metabolism of EETs, EpOMEs, and the corresponding diols in the kidney, potentially contributing to diurnal changes in the regulation of renal function.

Diet quality, timing, and frequency of food intake play a key role in metabolic health, including renal function, and previous observational studies have suggested that late‐night dinner (≥3 times per week) and bedtime snacking (≥3 times per week) are associated with an elevated risk of insulin resistance and chronic kidney disease [1, 6, 29]. Late‐night snacks are typically high in energy density, often including fried foods [30]. Thus, to explore how timed feeding of EpSA regulates renal function, we compared the phenotypes of mice with time‐restricted access to HFD containing EpSA in the light (LFO) or dark (DFO) phase and mice with ad libitum access to HFD, as illustrated in Figure 6A. Compared with observations in the control group, histological analysis of kidneys using HE, PAS, and Masson staining (Figure 6B) demonstrated a significant increase in glomerular size and fibrosis area increased significantly in the LFO group, accompanied by renal tubular vacuolar changes, mesangial cell proliferation, and basement membrane thickening. DFO treatment showed no obvious tubular injury or fibrosis in the kidney, although EpSA intake was low in mice fed with time‐imposed EpSA during the inactive period (Figure S10). These structural changes are direct evidence of time‐of‐day‐dependent differences in the harmful effects of dietary EpSA intake. In addition, serum BUN and creatinine levels in the LFO group were significantly higher than those in the control and DFO groups (Figure 6C).

By performing RNA‐seq‐based profiling of renal samples from the control and LFO group, KEGG enrichment analysis showed that timed feeding (light phase) of EpSA primarily affected pathways related to lipid metabolism (including oxylipin metabolism), oxidative phosphorylation, PI3K‐AKT, AMPK, MAPK signaling, insulin signaling, VEGF signaling, and insulin resistance (Figure 6D and Figure S11). The LFO group also showed increased expression and protein levels of Ephx1 and Ephx2 expression and protein levels (Figure 6E and Figure S12). Remarkably, a variety of studies have found that the physiological role of EETs is linked to the activation of the AMPK, PI3K‐AKT, and MAPK signaling pathways in insulin resistance, obesity, and kidney injury [31, 32]. Given that increased expression of EH‐encoding genes and the altered diol/epoxide ratio during the light phase with EpSA feeding, our data allow us to suppose that timed feeding of fried oil and its oxidation production (EpSA) disrupts the renal epoxide hydrolase clock to exacerbate the impairment of renal function. As expected, administration of EpSA elevated α‐SMA and E‐cadherin expression in TCMK‐1 cells treated with high glucose (Figure 6F,G and Figure S13). However, in Ephx1‐KO (Figures 6H,I) and Ephx2‐KO TCMK‐1 cells (Figure S14) treated with high glucose, the α‐SMA and E‐cadherin expression levels remained unchanged across groups. We also treated mice with AUDA, a potent pharmacological inhibitor of soluble EH (sEHs), to mimic the effects of sEH blockade. Timed feeding of EpSA during the light phase aggravated renal injury, whereas it failed to cause renal injury and fibrosis in AUDA‐treated mice (Figures 7D–F), as shown by insignificant changes in serum BUN and creatinine levels (Figure 7A–C). These data support the hypothesis that EpSA elicits time‐dependent effects on renal injury by disturbing EHs.

Among food lipids and associated minor content of components, linoleic acid (LA) has been identified as a natural competitive‐type inhibitors of epoxide hydrolase, with a Ki value of 3.52 µm [33]. In this study, we assessed the effect of LA on EH activity in mouse renal tubular epithelial (TCMK‐1) cells. Through in vivo sEHs activity assessment, linoleic acid inhibited sEH activity (Figure S15), and markedly reduced Ephx2 protein levels in TCMK‐1 cells (Figure S15). In addition, dietary LA attenuated kidney injury caused by time‐imposed feeding of EpSA during the inactive period. Histological assessment of kidney morphology using HE and Masson staining showed improvements in renal proximal tubular dilatation and tubular basement membrane thickness, along with reduced tubulointerstitial fibrosis in mice treated with an LA‐rich diet compared to those treated with EpSA alone (Figure 7G–J).

Fried oil was obtained by heating palm oil at 180°C to a TPC (Total Polar Compounds) value of 27 in an oil bath in the laboratory. Total polar compound levels in frying oils were analyzed according to our method previously reported [57]. The composition of TPC in fried oil samples was 20.02% polymerized triglycerides (PG), 30.01% oxidized triglycerides (ox‐TG) and 49.47% triglyceride degradation products (including free fatty acids and 2‐monoacylglycerol).

All of the experimental procedures followed the Guide for the Care and Use of Laboratory Animals: Eighth Edition (ISBN‐10: 0‐309‐15396‐4), and the animal experiments was approved by the animal ethics committee of Jiangnan University (JN.No20210630c1921001) in July 2021. 6‐week‐old male C57BL/6 mice were maintained in a 12:12‐h light–dark (LD) cycle. Long‐term high‐fat diet (HFD) feeding was used to induce renal injury in mice [58]. 6‐week‐old mice (SiPeiFu Biotechnology Co., Ltd, Beijing, China) fed a standard chow diet (Control, XTCON50J, 13% calories from fat), a high‐fat diet (HFD, XTHF60, 60% energy from fat), or a high‐fat diet containing 3% fried oil (thermo‐induced oxidized oil from palm oil) for 14 weeks, in which palm oil or oxidized oil as a fat source was incorporated (XTHF60, Xietong Shengwu, Jiangsu, China). Another cohort of 6‐week‐old mice fed a standard chow diet, or a high‐fat diet containing 3% palm oil, or a high‐fat diet containing 3% fried oil (thermo‐induced oxidized oil from palm oil) for 14 weeks. These mice were fed under AL feeding (Ad libitum feeding) or light‐restricted feeding (ZT0‐ZT12). The third cohort of 6‐week‐old mice fed a standard chow diet, or a high‐fat diet containing 3% palm oil, or a high‐fat diet containing 3% fried oil (thermo‐induced oxidized oil from palm oil) for 14 weeks. A high‐fat diet containing 3% fried oil was time‐imposed on mice during the light phase (LFO, ZT0‐ZT12) or dark phase (DFO, ZT12‐ZT24). The other cohort of 6‐week‐old mice fed a standard chow diet, a high‐fat diet, or a high‐fat diet containing 3% EpSA for 14 weeks. A high‐fat diet containing 3% EpSA was time‐imposed to mice during the light phase (ZT0‐ZT12). ZT0 denotes lights‐on and ZT12 denotes lights‐off. The last cohort of 6‐week‐old mice fed a high‐fat diet containing 3% EpSA or a high‐fat diet containing 3% EpSA and 3% linoleic acid for 14 weeks. These mice were time‐restricted to mice during the light phase (ZT0‐ZT12). The renal injury score was assessed in a blinded manner and scored by the percentage of injured tubules, as follows: 0, no damage; 1, <25%; 2, 25%–50%; 3, 50%–75%; 4, >75%. Semi quantitative assessment of fibrosis area was carried out using Image Pro Plus 6.0 (Media Cybernetics).

The PX459 plasmid (#48139, Addgene, Cambridge, MA, USA) was used to construct Ephx1 and Ephx2 KO plasmids [59]. PX459 plasmid was a gift from Feng Zhang, Broad Institute, Cambridge, MA, obtained via Addgene (62988). Ephx1 and Ephx2 KO by CRISPR/Cas9 was performed as described previously. Insert oligonucleotides that include a guiding RNA sequence were designed as follows: for Ephx1 KO, GGAGCTCTTGTACCCATTCA and GCCCCTCGGGTGATTCCGTTC; for Ephx2 KO, GCTTGATCATCCCAACCTGACG and GTCCCTCTGGGAATTCCGTC. After annealing, these oligonucleotides were inserted to the BbsI cloning site of PX459. These plasmids and unmodified PX459 plasmid were transfected to TCMK‐1 cells by Lipofectamin 2000. The validation of knockout clones were shown in Figures S16 and S17.

TCMK‐1 cell (ATCC CCL‐139TM, Pricella Biotechnology Co., Ltd., China), the tubular epithelial cells in mice were maintained in MEM medium with 10% FBS. TCMK‐1 cell was cultured at 37°C, 95% air, and 5% CO₂.

As for serum samples, precisely aspirate 90 µL of plasma under dark conditions and place it in a 1.5 mL centrifuge tube. Add 5 µL of methanol, vortex for 30 s, and then add 500 µL of ethyl acetate, vortex for 3 min and let it stand for 1 min. Centrifuge at 20,000 rpm at 4°C for 5 min. Transfer the supernatant to a 10 mL covered glass tube, dry it with nitrogen gas at room temperature, dissolve the residue with 200 µL mobile phase, vortex for 30 s, and transfer it to a 1.5 mL centrifuge tube. Centrifuge at 20,000 rpm at 4°C for 5 min, and pass the supernatant through a 0.22 µm filter membrane, Perform HPLC MS/MS analysis. As for kidney samples, grind the solid sample in a liquid nitrogen environment until crushed, take approximately 100 mg of each tissue sample, rinse with physiological saline, dry with filter paper, and weigh. Add 500 µL of methanol (containing 0.01 mol/L BHT) and 10 µL of formic acid, mix well, homogenize in a homogenizer, and sonicate to break the cells (working time 3 s, gap time 2 s, working 60 times, power 400 W). The above process is carried out in an ice bath. Centrifuge at 4°C for 20 min (15000 r/min), remove the supernatant, add 700 µL of water and 1 mL of ethyl acetate, vortex for 30 s, centrifuge at 12000 r/min for 10 min, remove the organic phase, extract the aqueous phase again, merge the ethyl acetate layer, freeze dry the solvent, dissolve the residue in 200 µL of methanol, centrifuge at 20000 rpm for 5 min at 4°C, take the supernatant and pass through a 0.22 µm filter membrane for HPLC MS/MS analysis.

Collected kidney were frozen in liquid nitrogen and homogenized. To the homogenized sample, methanol was added and homogenized in the identical condition. 200 µL of suspension in methanol was mixed with 100 µL chloroform and incubated for 1 h. Subsequently, 20 µL of water was added. After extraction, samples were centrifuged at 3500×g for 25 min, and the supernatants were collected. Untargeted lipidomic was performed by using an UPLC (AB SCIEX ExionLC) coupled with a TOF‐MS (AB SCIEX, Triple TOF 5600+). Chromatographic separations were performed on a Kinetex C18 columns (100 mm x 2.1 mm, 2.6 µm, Phenomenex). The mobile phase A was an acetonitrile‐water mixture containing 10 mm ammonium acetate (acetonitrile: water = 2:3, v/v), and mobile phase B was an acetonitrile‐isopropanol mixture containing 10 mm ammonium acetate (acetonitrile: isopropanol = 1:9, v/v). The elution gradient was started with 35% B keeping for 1 min, increasing to 60% B in 1 min, then rising to 100% B in 11 min and holding for 3.5 min. Next, the elution fell to 35% B in 0.5 min and maintaining for 1.5 min. The ESI source was set at 500°C, decluttering potential 90 V, collision energy 40 ± 20 V, spray voltage of 5500 V in positive mode or −4500 V in negative mode.

Frozen tissue samples were homogenized and RNA was isolated with Spin Column Animal Total RNA Purification Kit (Sangon Biotech (Shanghai) Co., Ltd., B518651) according to the manufacturer's instructions. 1 µg total RNA was used for following library preparation. Sequencing was performed on an Illumina Novaseq platform using a 2 × 150 paired‐end (PE) configuration according to manufacturer's instructions. Renal transcriptome analysis, rhythmic analysis, and Phase parameter analysis were calculated by MetaCycle (meta2d_phase). MetaCycle package is available on the CRAN repository (https://cran.r‐project.org/web/packages/MetaCycle/index.html↗) and GitHub (https://github.com/gangwug/MetaCycle↗).

Immunofluorescence staining were performed in OCT‐embedded kidneys section. The following antibodies were used for the immunofluorescence analyses. Nuclei were counterstained with DAPI. The slides were inoculated in primary antibody anti‐E‐cadherin (ab231303, Abcam, Cambridge, USA, 1:1000) and anti‐α‐SMA (ab5694, Abcam, Cambridge, USA, 1:200). Alexa Fluor 488‐labeled goat anti‐rabbit IgG (111‐585‐003; Jackson) and Goat anti‐mouse IgG‐CY3 (GB21301; Servicebio) were used as secondary antibodies. Fluorescence images were gathered at 200× and 400× magnification using an upright fluorescence microscope (NIKON ECLIPSE C1, Nikon, Japan). The fluorescence intensity was computed using Image Pro Plus 6.0 (Media Cybernetics).

TRIzol reagent (Yeason, China) was used to extract the total RNA from kidney, and cDNA Synthesis Mix was used to reverse‐transcribe the recovered RNA (Yeason, China). The QT‐PCR was carried out on a QuantStudio 5 System. The internal reference utilized to calculate the relative expression level of mRNA was 36B4. Primer sequences were detailed in Table. S1

Western blot analysis protocols have been previously described [60]. All kidney tissue were homogenized in RIPA lysis buffer (Beyotime, Shanghai, China, #P0013B) supplemented with PMSF (Beyotime, Shanghai, China, #ST505), phosphatase inhibitor cocktail (Beyotime, Shanghai, China, #P1082) and protease inhibitor cocktail (Beyotime, Shanghai, China, #P1006). The total protein were extracted and were separated by SDS‐PAGE, transferred to PVDF membranes (Millipore, Billerica). Membranes were blocked in a blocking buffer (Beyotime, Shanghai, China, #P0023B) and incubated with primary antibodies. Primary antibody anti‐E‐cadherin (ab231303, Abcam, Cambridge, USA, 1:2000), anti‐α‐SMA (ab5694, Abcam, Cambridge, USA, 1:2000), anti‐Ephx1 (66982‐1‐Ig, Proteintech, Wuhan, 1:2000), anti‐Ephx2 (10833‐1‐AP, Proteintech, Wuhan, 1:1000), and Tubulin antibody (10094‐1‐AP, Proteintech, 1:5000) were used. BeyoECL Plus regent was used to detect the signal.

Soluble epoxide hydrolases (sEHs) activity was performed using a Soluble Epoxide Hydrolase Cell‐Based Assay Kit (Cayman, No.600090, Michigan, USA) according to the manufacturer's instructions.

Serum KIM‐1 and Nga (mouse) were detected by using ELISA Kit (Sangon Biotech (Shanghai) Co., Ltd., Shanghai, China).

All results were expressed as means ± SEM. GraphPad Prism (version 8.0, Boston, USA) was used for statistical analyses. Statistical significance was determined by Student's t test or two‐way ANOVA models between‐group comparisons. When comparing more than 2 groups, we used two‐way ANOVA were used for group comparisons and Holm–Sidak method was used for p‐value adjustment for multiple comparisons. A p value of 0.05 or less was indicated a significant difference.