What this is
- Idiopathic pulmonary fibrosis (IPF) is a severe lung disease characterized by excessive fibrosis and a poor prognosis.
- Transglutaminase 2 (TG2) plays a significant role in promoting the and () deposition in IPF.
- This research explores the potential of TG2-selective inhibitors to reverse myofibroblast characteristics and reduce accumulation.
Essence
- TG2-selective inhibitors can reverse the in IPF fibroblasts, reducing deposition and myofibroblast markers. This positions TG2 as a promising therapeutic target in IPF.
Key takeaways
- TG2 inhibition led to a reduction in myofibroblast markers and proteins in IPF fibroblasts. Selective inhibitors like 1–155 and R281 effectively reversed the .
- Exogenous TG2 treatment induced myofibroblast characteristics in normal human lung fibroblasts (NHLFs) via TGFβ1 activation. This underscores TG2's role in driving fibrosis.
- TG2-selective inhibitors disrupted the feedback loop between TG2 and TGFβ1, which is crucial for sustaining fibrosis in IPF. This mechanism indicates a potential therapeutic strategy.
Caveats
- The study primarily relies on in vitro models, which may not fully replicate the complexity of IPF in vivo. Further research is needed to validate these findings in clinical settings.
- While TG2 inhibition shows promise, the long-term effects and potential side effects of these inhibitors require thorough investigation before clinical application.
Definitions
- myofibroblast phenotype: A cell state characterized by increased contractility and ECM production, often associated with fibrosis.
- extracellular matrix (ECM): A network of proteins and carbohydrates surrounding cells, providing structural and biochemical support.
AI simplified
Introduction
Idiopathic pulmonary fibrosis (IPF) is an incurable and life-threatening disease with a median survival rate of 2–3 years in the UK (Strongman et al. 2018). The most common cause of death is respiratory failure, accounting for over 80% of deaths (Raghu et al. 2006). Histological analysis of IPF samples show thick collagen and ‘fibroblast foci’ in areas of fibrosis (Kekevian et al. 2014). Increased proliferation of fibroblasts and excessive deposition of extracellular matrix (ECM) proteins above the rate of ECM degradation characterises IPF (Dragsbaek et al. 2015; Ramos et al. 2001). It has been demonstrated by Mora et al. that there has been a high attrition rate for drugs that enter clinical trials for the treatment of IPF, and, therefore, this highlights the demand for promising new targets to be identified (Mora et al. 2017).
Transglutaminase 2 (TG2), is a calcium-activated multifunctional enzyme, well known for the formation of ε-(γ-glutamyl)lysine isopeptide bonds that lead to protein cross-linking, that provide resistance to proteolytic cleavage and ultimately, stabilisation and increased stiffness of the ECM (Bergamini et al. 2011; Wang and Griffin 2012). TG2 is reported to have various pathological roles, including cancer metastases (Ayinde et al. 2017; Kotsakis et al. 2011; Wang and Griffin 2013), coeliac disease (Nadalutti et al. 2013) and tissue fibrosis (Badarau et al. 2015; Wang et al. 2018). TG2 knockout (KO) mice show reduced fibrosis in response to bleomycin-induced pulmonary fibrosis, including a marked reduction in collagen deposition (Oh et al. 2011). However, the actual mechanism(s) of TG2′s role in IPF remains unknown. Importantly, TG2-selective inhibitors have not yet been tested in IPF.
Use of irreversible small molecule TG2 inhibitors in a rat diabetic nephropathy model showed that TG2 inhibition led to reduced glomerulosclerosis and tubulointerstitial fibrosis by up to 77% and 92%, respectively (Johnson et al. 2007). Recently, the TG2-selective and irreversible inhibitor 1–155 used in this study and developed at Aston University resulted in upto a 40% reduction in collagen deposition in a mouse Angiotensin II model of nephrosclerosis and a 60% reduction in infarct size in an acute myocardial infarction mouse model (Badarau et al. 2015; Wang et al. 2018). These previous studies demonstrate the potential of site-directed TG2-selective inhibitors for the treatment of tissue fibrosis.
Apart from its importance in generating a protease-resistant crosslinked fibrotic matrix, TG2 can release the active transforming growth factor β1 (TGFβ1) from ECM via crosslinking the large latent TGFβ1-binding protein (LTBP)-TGFβ1 complex in the ECM (Verderio et al. 1999). TGFβ1 is a crucial pro-fibrotic cytokine that promotes fibrosis via fibroblast-to-myofibroblast transition (Wang et al. 2018), epithelial–mesenchymal transition (EMT) (Nyabam et al. 2016) and endothelial–mesenchymal transition (EndMT) (Wang et al. 2017), promoting myofibroblast activation, inducing ECM protein expression and deposition and inhibiting matrix degradation pathways leading to matrix accumulation.
Here we demonstrate how TG2 is involved in inducing the myofibroblast phenotype in IPF cells. We also demonstrate the potential of using site-directed TG2-selective inhibitors as therapeutic agents for IPF. We show that these inhibitors can reduce matrix deposition and reverse the myofibroblast phenotype in IPF via preventing the activation of TGFβ1, reducing myofibroblast biomarkers and inhibiting excessive matrix protein deposition.
Results
Increased expression of TG2 and myofibroblast markers in IPF fibroblasts
Characterisation of NHLFs and IPF fibroblasts.Representative Western blots of TG2, FN and αSMA in the cell lysates of NHLFs and IPF fibroblasts. GAPDH was used to normalise loading.Representative blots of TG2, FN and TGFβ1 in ECM fractions of NHLFs and IPF fibroblasts.andare graphs showing mean densitometry values ± S.D. with the NHLFs taken as 1.0. *,< 0.05; **,< 0.01; and ***,< 0.001 a c b d p p p
Overexpression of active TG2 leads to a myofibroblast phenotype in NHLFs
Overexpression of catalytically active TG2 in NHLFs induces Smad3 signalling and a myofibroblast phenotype.Representative Western blot of TG2 in NHLFs cell lysates following lentiviral transduction. VC, vector control.,Representative Western blots of TG2, FN and αSMA in NHLFs transduced with empty vector (VC), wt-TG2 and C277S-mutant TG2 (C277S-TG2).–Representative Western blots of p-Smad3 in VC, wt-TG2 and C277S-TG2 lentivirus transduced NHLFs. Graphs based on densitometry analysis of Western blots are shown in–andexpressed as a mean fold change ± SEM compared with VC or NHLFs control taken as 1.0. GAPDH was used to ensure equal loading. *,< 0.05; **,< 0.01; ***,< 0.001; and NS, not significant a b c d g b f h p p p
TGFβ1 involvement in the TG2-regulated myofibroblast transition in NHLFs
TGFβ1 stimulation of NHLFs regulates TG2 protein levels and ECM deposition.Representative images of TG2 staining (green) in NHLFs treated with different concentrations of TGFβ1 with Hoechst (blue) staining.Dose–response curve of TG2 levels against log TGFβ1 concentration. Mean percentage increase ± SEM in cell count (blue) also shown. The images were quantified as described in “Materials and methods”.–Representative Western blots of TG2 in cell surface and cell lysatesand matrix TG2 and FNfollowing treatment of NHLFs with TGFβ1 (1 ng/ml). Na + /K + ATPase was used as a cell surface loading control. Graphs based on densitometry analysis of Western blots with controls normalised to 1.0 are shown inand. GAPDH was used to ensure equal loading for cell lysates. Data are shown as a mean fold change ± SEM of control cells. **,< 0.01; and ***,< 0.001 a b c f c f d f p p
Exogenous active TG2 leads to a myofibroblast phenotype in NHLFs via TGFβ1
In addition, treatment of NHLFs cells with inhibitors of ERK signalling, ALK5 receptor or a TGFβ neutralising antibody (TGFβ-NA) all resulted in the inhibition of the increased expression of TG2, FN and αSMA induced by exogenous TG2 (Fig. 4h–j), confirming that exogenous TG2 functions through the TGFβ1 pathway(s) in inducing TG2, FN and increased TGFβ in NHLFs.
The effect of Rh-TG2 stimulation on NHLFs lysate and matrix protein levels.Representative Western blots of TG2, FN and αSMA andmatrix TG2, FN and monomeric TGFβ1 in NHLFs treated with exogenous Rh-TG2 (1 µg/ml) and untreated NHLFs.Representative Western blots of p-SMAD3 and t-SMAD3 in control NHLFs and NHLFs treated with 1 µg /ml Rh-TG2 for 2 or 6 h.Graph showing the presence of active TGFβ in IPF fibroblasts treated with Rh-TG2 (1 µg/ml) via the Mink TGFβ reporter system as described in the “Materials and methods”.Representative Western blots of TG2 and FN in NHLFs treated with an ERK inhibitor (10 µM), a TGFβ neutralising antibody (20 µg/ml) or an Alk5 inhibitor (10 µM) in the presence of Rh-TG2 (1 µg/ml). Graphs based on densitometry analysis of Western blots with controls normalised to 1.0 are shown in–andexpressed as a mean fold change ± SEM. GAPDH was used to ensure equal loading. *,< 0.05; **,< 0.01; and ***,< 0.001 a c e g h b i j p p p
Selective inhibition of TG2 reverses the TGFβ1-induced myofibroblast phenotype in NHLFs
TG2-selective inhibitors prevent the TGFβ1-induced increases in TG2 activity, the myofibroblast phenotype and ECM protein deposition.TG2 in situ activity measured via FITC-cadaverine incorporation following treatment of NHLFs with TGFβ1 (1 ng/ml) and TG2 inhibitors (1–155 and 281). TG2 activity (green) and DAPI (blue).Relative fluorescent signals of treated NHLFs against the control. Control fluorescent signals were normalized to 100%. Fluorescent signals were measured via ImageJ software.Representative Western blots of TG2 and FN in control and NHLFs treated with TGFβ1 and TG2 inhibitor 1–155.Representative Western blots of TG2 and FN from ECM fractions of NHLFs treated with TGFβ1 and TG2 inhibitor 1–155.Representative Western blots of αSMA in control NHLFs, TGFβ1-treated NHLFs and NHLFs treated with TG2 inhibitor 1–155 or R281 with TGFβ1. Graphs based on densitometry analysis of Western blots with controls normalised to 1.0 are shown in–and. GAPDH was used to ensure equal loading data in the graphs are expressed as a mean fold change ± SEM compared to the control NHLFs. *,< 0.05; **,< 0.01; and ***,< 0.001 a b c f i b h j p p p
TGFβ1-mediated TG2 expression involves Smad3
CRISPR-Cas9 genome editing was performed on IPF fibroblasts targeting the Smad3 and TGM2 gene. IPF fibroblasts underwent CRISPR-Cas9 genome editing as described in the “Materials and methods” targeting the SMAD3 and TGM2 genes. Representative images of immunocytochemistry staining of TG2 in the TG2 KO, SMAD3 KO and WT IPF fibroblasts in the absenceand presenceof TGFβ1 stimulation. TG2 (green), Hoechst (blue).andGraphs present the percentage of the signals measured via immunocytochemistryas described in the “Materials and methods”. Quantitative data was generated using the ‘Mean_TargetAvgIntenCh2′ algorithm and the ‘AP30704v1_SIAJCollagenandCellCountCellHealth (V01)’ protocol. Data are expressed as a percentage of control ± SEM. **,< 0.01; and ***,< 0.001 a c b d p p
Selective TG2 inhibition can reverse the myofibroblast phenotype in IPF fibroblasts
Figure 7i and j demonstrate that treatment of IPF fibroblasts with cell impermeable TG2 inhibitor R281 led to a reduction in p-SMAD3 levels compared to the control IPF fibroblasts, with p-ERK1/2 levels also decreasing in the presence of R281 (Fig. 7k and l). To gain a greater understanding of the regulation of TG2 expression, IPF fibroblasts were treated with an inhibitor of ERK and an ALK5 receptor inhibitor. Both ALK5 and ERK inhibition led to a reduction in TG2 expression compared to the control IPF fibroblasts (Fig. 7m and n).
Treatment of IPF fibroblasts with TG2-specific inhibitors and the relationship with Smad3 and ERK1/2 signalling pathways.Representative Western blot of TG2, FN and αSMA in control IPF fibroblasts and IPF fibroblasts treated with either TG2 inhibitor 1–155 (2.5 µM) or R281 (500 µM).Representative Western blots of TG2, FN and TGFβ1 from ECM fractions of IPF cells treated as shown.Representative Western blots of p-SMAD3 and t-SMAD3 andp-ERK1/2 and t-ERK1/2 in the control IPF fibroblasts and R281 treated IPF fibroblasts.Representative Western blots of TG2 in control IPF fibroblasts and IPF fibroblasts treated with an ALK5 or an ERK inhibitor. Graphs based on densitometry analysis of Western blots with controls normalised to 1.0 are shown in–and. GAPDH was used to ensure equal loading data in the graphs are expressed as a mean fold change ± SEM compared to the control NHLFs *,< 0.05; **,< 0.01; and***,< 0.001 a e i k m b l n p p p
Discussion
The involvement of TG2 in lung fibrosis was first proposed by (Griffin et al. 1979). Later studies have now shown that increased expression of TG2 is found in the lungs of IPF patients and that TG2-KO mice develop significantly reduced bleomycin-induced fibrosis compared to wild-type mice (Olsen et al. 2014). This same group investigated two small electrophilic compounds CDDO and 15d-PGJ2 that were reported to block myofibroblast formation and matrix deposition in normal human fibroblasts (Olsen et al. 2011). They demonstrated that in normal and IPF-derived fibroblasts that TG2 expression was reduced by these two small molecules although in IPF derived fibroblasts this reduction in TG2 expression was less effective. They concluded that the ability of these small molecules to reduce TG2 expression and inhibit fibrosis was via inhibition of ERK signalling.
More recent studies have demonstrated that the pan transglutaminase inhibitor cystamine reduces collagen deposition in the mouse bleomycin model of lung fibrosis (Philp et al. 2018). However, unlike selective TG2 inhibitors such as 1–155 used in this study, cystamine inhibits other transglutaminases, as well as cysteine proteases, such as Caspase 3.
In this paper, we confirm previous data showing that TG2 protein levels are significantly increased in IPF fibroblasts compared to NHLFs (Olsen et al. 2014). In addition, we demonstrate that treatment of primary IPF fibroblasts with a TG2-selective inhibitor 1–155 and a cell impermeable TG2 inhibitor R281 reverses the myofibroblast phenotype with reduced expression of FN, TG2 and αSMA and reduced deposition into the ECM of TG2, FN and TGFβ1. These data are in keeping with our previous data showing that TGFβ1 induction of cardiofibroblasts into myofibroblasts and the parallel increase in matrix deposition could be inhibited using selective TG2 inhibitor 1–155, which when translated into mouse models of cardiac fibrosis and nephrosclerosis indicated that treatment with 1–155 caused a significant reduction of collagen deposition in these different animal models. Hence it is not unreasonable to assume that TG2 selective inhibitors like 1–155 are able to reduce fibrosis in animal models of lung fibrosis such as the bleomycin model commonly used for preclinical studies.
Our findings confirm previous studies in that over-expression of TG2 in NHLFs leads to increased matrix protein levels (Olsen et al. 2014). In addition, our study also shows that over-expression of TG2 in NHLFs leads to upregulation of αSMA protein levels compared to control cells; however, previous research by Olsen et al. found no differences in αSMA protein (Olsen et al. 2014). NHLFs express very low levels of αSMA, but research by Olsen et al. showed αSMA protein levels to be relatively high in NHLFs transduced with a control virus (Olsen et al. 2014). However, we did not encounter any phenotype changes in empty vector transduced NHLFs. Our study revealed a marked increase in αSMA protein levels following over-expression of TG2 in NHLFs compared to the low levels of αSMA protein in NHLFs transduced with control virus.
TGFβ1 has previously been reported to upregulate TG2 expression by activating the TGFβ1 response element located within the TGM2 gene promoter (Nunes et al. 1997) which supports our observations within this study. Furthermore, knockout of SMAD3 in IPF cells by CRISPR-Cas9 genome editing suggests that TGFβ1 also utilises SMAD3 signalling for the upregulation of TG2. However, our data also show that SMAD3 is not the sole regulator of TGFβ1-induced upregulation of TG2. Previous research identified a phosphorylation signalling cascade involving ERK activation also regulates TG2 expression and targeting ERK with inhibitors could reduce TG2 expression in fibrotic lung fibroblasts (Olsen et al. 2011). This suggests that TGFβ1-induced upregulation of TG2 is likely to be regulated by both canonical (SMAD3) and non-canonical (ERK) TGFβ1-induced signalling which may explain why 60% knockout of SMAD 3in IPF fibroblasts only gave rise to around 25% decrease in TG2 expression when compared to control cells.
We show that addition of exogenous TG2 to NHLFs leads to increased expression of TG2, FN and αSMA, with increased matrix deposition of TG2, FN and activated TGFβ1. We also show that addition of TG2 to IPF cells which already show the myofibroblast phenotype leads to a significant increase in active TGFβ1 levels in the culture medium. Since TG2 inhibition blocked this response in NHLFs, this suggests that the increased TGFβ1 levels are resulting from TG2 activation of latent matrix-bound TGFβ1,through a mechanism demonstrated by (Nunes et al. 1997).This in turn leads to induction of the myofibroblast phenotype since both the cell impermeable inhibitor 281 and the cell permeable inhibitor 1–155 which acts both at the intra-and extracellular level blocked expression of both TG2 and the myofibroblast marker αSMA. It has also been reported that TG2 crosslinking of the ECM can lock active TGFβ1 into the matrix which may be a mechanism for prolonging the half-life and creating an active reservoir of this transient growth factor (Nyabam et al. 2016; Wang et al. 2017). This phenomenon has also been observed with VEGF (Wang et al. 2013). Further support for such a mechanism comes from the finding that when TGFβ is incorporated into TG crosslinked collagen it remains active and capable of cell signalling (Niger et al. 2013). Addition of exogenous TG2 also led to an increase in activated TGFβ1 presence in the ECM, which supports this theory. Importantly in relation to in vivo studies (Johnson et al. 2007), TG2 has been shown to be found in high levels in the extracellular matrix where it will activate matrix bound latent TGFβ1 leading to a positive feedback-loop between TG2 and TGFβ1 which we demonstrate in primary NHLFs. Targeting TG2 using TG2-selective inhibitors can disrupt this pro-fibrotic feedback loop preventing progressive fibrosis from occurring as we demonstrated in both cardiac (Wang et al. 2018) and kidney fibrosis mice models (Badarau et al. 2015; Johnson et al. 2007).
Previous researchers have suggested that TG2 activity is critical for the extracellular crosslinking of ECM proteins that leads to proteolytic-resistant fibrotic lesions (Collighan and Griffin 2009). We demonstrate that treatment of TGFβ1-stimulated NHLFs with a TG2-selective inhibitor leads to a reduction in TG2 activity, myofibroblast transition and ECM deposition of TG2, FN and activated TGFβ1. Furthermore, TG2 inhibition prevented the increase in FN expression and importantly prevented the increase in expression of the key myofibroblast marker αSMA, whose expression could also be inhibited by the cell impermeable TG2 inhibitor 281 confirming TG2′s action on TGFβ1 is occurring outside the cell. Moreover, TG2 inhibition prevented the increase in FN and αSMA expression that was induced by over-expression of TG2 in NHLFs both in the presence and absence of TGFβ1. These data further support our hypothesis that inhibition of TG2 using either a cell permeable or cell impermeable inhibitor prevents the positive-feedback loop between TG2 and TGFβ1, leading to reduced myofibroblast presence and excessive deposition of ECM proteins.
Previous research showed that TGFβ stimulation of healthy lung fibroblasts leads to an increase in ECM and cell surface levels of TG2 but no change in cytosol TG2 was observed following stimulation (Olsen et al. 2011). In contrast, we found that TG2 protein levels were significantly increased in both whole cell lysates and in the ECM following treatment with TGFβ1 which may be due to the different concentrations of TGFβ1 used in the two studies.
Schematic showing how TG2 inhibitors block fibrosis during IPF. The vicious cycle between TG2 and TGFβ1 leads to the transformation of lung fibroblasts into myofibroblasts which subsequently results in the increase of fibrotic tissue and further active TGFβ1, leading to sustained expression of TG2. Inhibiting this vicious cycle using selective TG2 inhibitors attenuates the progression of fibrosis during IPF
Materials and methods
Chemicals
General chemicals used within this study were purchased from Sigma-Aldrich (UK) unless stated otherwise.
Cells
Primary NHLFs and Human IPF Fibroblasts cells were supplied by GSK (UK). The cells were used up to a maximum of passage 8. MLECs were gifted by Professor Daniel Rifkin (New York University, USA).
Cell culture
NHLFs and IPF fibroblastss were cultured in complete DMEM containing Ultraglutamine (glutamine 4.5 g/l), 1% (v/v) non-essential amino acids (NEAA) and 10% (v/v) foetal calf serum (FCS) supplementation. MLECs were cultured in complete DMEM containing 2 mM glutamine, 10% (v/v) FCS and 250 μg/ml G418 sulphate. The medium was changed every 48 to 72 h. NHLFs and IPF fibroblasts were maintained at 37 °C in a 10% CO2-humidified incubator, whilst MLECs were cultured at 37 °C in a 5% CO2-humidified incubator.
Cell treatments
TG2-selective inhibitor 1–155 (Badarau et al. 2015) and extracellular-acting TG2 inhibitor R281 (Badarau et al. 2013) were synthesised in Aston University laboratories. Recombinant human TG2 (Rh-TG2) was from Zedira (Germany). Transforming growth factor β1 (TGFβ1) and ERK inhibitor (PD98059) were purchased from R and D Systems (UK).
Lentiviral transduction of NHLFs
NHLFs were transduced with lentiviral particles containing TG2 and a control empty lentivirus. Lentiviral transduction was performed as previously described (Wang et al. 2013). Cells were cultured to 80% confluency in a 60 mm Petri dish, followed by two rounds of lentiviral transduction. The transduction efficiency was confirmed using Western blotting.
CRISPR-Cas9 gene editing
The gRNAs were designed using a free online tool (Deskgen). The two gRNA sequences used for TG2 KO were 'GTCTTGCTGGTCCACCACGG' and 'TGAGGCGATACAGGCCGATG' which both target exon 3 in the TGM2 gene. For SMAD3 gene deletion the cells used in this study and the gRNA sequence used to achieve gene editing of Smad3 was ‘GAGCTGACACGGAGACACAT’ as published by Martufi et al. with only a single RNA electroporation performed using the method described in the same paper (Martufi et al. 2019). Briefly, the gRNA was diluted in nuclease-free duplex buffer at 25 µM before boiling at 95 °C for 5 min and then cooling for a further 10 min at RT. The RNA (72.5 pmol) was then complexed with the Cas9 enzyme (60 pmol) and incubated at RT for 10 min before adding 60 pmol of electroporator enhancer and incubating for a further 5 min at RT. IPF fibroblasts (2.5 × 105 cells) were then washed with PBS, pH 7.4, before being pelleted by centrifugation at 90 × g for 10 min. The cells were re-suspended in 15.5 µl P3 solution (Lonza, UK) and then 4.5 µl of the gRNA complex was added. The electroporation was performed in 16-well Nucleocuvette strips. The IPF fibroblasts were then plated into a 24-well plate and incubated in a 37 °C, 10% CO2-humidified incubator for 24 h. The next-generation sequencing and analysis was performed by Matteo Martufi (GlaxoSmithKline).
MLEC TGFβ reporter assay
Active TGFβ levels were measured using the MLEC TGFβ reporter assay (Abe et al. 1994). Fibroblasts were seeded at a density of 5 × 104 cells/well in a 96-well plate in DMEM containing 0.4% FCS. Rh-TG2 was immediately added to the appropriate wells and then the plate was incubated at 37 °C in a 10% CO2-humidified incubator for 16–24 h. Following the incubation, MLECs were seeded at a density of 2.5 × 104 cells/well in a collagen-coated 96-well plate using DMEM containing 0.4% FCS and G418 sulphate (250 µg/ml). The MLECs were incubated at 37 °C in a 5% CO2-humidified incubator for 3 h before replacing the medium with medium taken from the fibroblasts. The MLECs were cultured overnight with medium from fibroblasts at 37 °C in a 5% CO2-humidified incubator before replacing the medium with serum-free medium. Bright-Glo reagent (Promega) was then added to the serum-free medium and the plate was incubated for 2 min before transferring the total volume to a white-walled 96-well plate. The plate was read on a SpectraMax-L luminescent plate reader.
In situ TG2 activity using FITC-cadaverine incorporation
In situ TG2 activity assay was performed as described previously (Jones et al. 2013). Fibroblasts were seeded at a density of 8 × 104 cells/well in an 8-well chamber slide and incubated overnight in a 37 °C, 10% CO2-humidified incubator. Fresh medium and treatments were then added before replacing these after 24 h. Following 48-h incubation with treatments, fresh medium containing 0.5 mM FITC-cadaverine was added and incubated for further 16 h in a 37 °C, 5 or 10% CO2-humidified incubator. Following the incubation, medium was discarded and the cells were washed three times with PBS, pH 7.4. The cells were fixed with 3.7% (v/v) paraformaldehyde in PBS, pH 7.4, for 15 min at RT before washing three times with PBS, pH 7.4. The slide was mounted with Vectorshield mounting medium and detected using confocal microscopy. Quantification of fluorescence was performed using ImageJ software.
Western blotting
For matrix protein analysis where no suitable loading standard was available, equal cell numbers were always used at the start of the experiment. To obtain the cell matrix proteins, gentle removal of cells was undertaken using 5 mM EDTA in PBS, pH74, and the remaining matrix proteins dissolved via scraping into equal volumes of 2 × Laemli buffer (30 µl). The total matrix from each sample was then loaded onto SDS PAGE gels. The western blotting protocol was undertaken as described previously (Wang et al. 2011, 2012). Parallel experiments on the analysis of viable cell numbers with or without treatment with TGF β1 for 72 h indicated that the viable cell numbers were comparable in the TGFβ1 treated and untreated cells (data not shown).
Following primary and secondary antibody incubation, images were captured by a chemiluminescent image analyser Syngene G-box F3 (Cambridge, UK). Densitometry was performed with ImageJ software. The intensity of the bands was normalized against the GAPDH band. The ratios are shown against controls (normalized as 1.0). Data are expressed as mean ratios ± SEM taken from at least three separate experiments unless stated.
| Primary antibody target | Source |
|---|---|
| TG2 (Cub7402) | Abcam, UK |
| FN (F3648) | Sigma-Aldrich, UK |
| αSMA (A2547) | Sigma-Aldrich, UK |
| p-ERK1/2 (sc-7383 HRP) | Santa Cruz Biotechnology, USA |
| ERK1/2 (sc-514302 HRP) | Santa Cruz Biotechnology, USA |
| p-SMAD3 (ab52903) | Abcam, UK |
| SMAD3 (ab40854) | Abcam, UK |
| Syndecan-4 (ab24511) | Santa Cruz Biotechnology, USA |
| GAPDH (ab8245) | Abcam, UK |
| TGFβ1 (sc-130348 HRP) | Santa Cruz Biotechnology, USA |
| Collagen type 1 (C2456) | Sigma-Aldrich, UK |
| Secondary antibody | Source |
| Swine anti-rabbit HRP-conjugated | Dako, Denmark |
| Goat anti-mouse HRP-conjugated | Dako, Denmark |
Cell surface TG2 protein detection via biotinylation
Cells were seeded at a density of 5 × 105 cells/60 mm Petri dish and incubated for 2 h before treatments were added. The cells were then incubated for 24 h at 37 °C in a − 10% CO2-humidified incubator. The presence of TG2 at the cell surface was detected via biotinylation (Wang et al. 2012) with EZ-link Sulfo-NHS-Biotin (Thermo, UK) according to the manufacturer’s protocol and analysed via Western blotting.
Isolation of ECM fractions
ECM fractions of the cell cultures were collected as described previously (Wang et al. 2018). Cells were seeded in 35 mm Petri dishes at a density of 2 × 105 cells/dish. Treatments were performed for 72 h before ECM fractions were collected. Cell detachment was performed with 5 mM EDTA in PBS, pH 7.4. The dish was then washed twice with PBS, pH 7.4. The ECM was collected by dissolution in 2 × Laemmli buffer and then underwent protein analysis using Western blotting.
Statistical analysis
Results shown are mean values ± SEM with data taken from at least three separate experiments unless otherwise stated. The statistical significance between data groups was calculated using either a two-tailed t test or one-way ANOVA using GraphPad Prism. Following analysis using ANOVA, a Tukey post hoc test was performed to identify statistical differences between groups. p < 0.05 was considered statistically significant. The results were analysed in Microsoft Excel. GraphPad Prism was used to create graphs, perform statistical analysis and calculate EC50 values.