Improving Cas12a proteins for more precise genome editing

Cas12a has been noted as a very prominent tool for gene editing with low off-targeting. Our previous work identified CeCas12a and other variants with stringent PAM recognition to further lower the off-targeting [36,37]. However, the relatively high off-targeting still existed in the distal end of the PAM. To further investigate the off-targeting in the proximal and distal end of the PAM, AsCas12a was selected since its high-resolution structure has been solved [38]. Firstly, 4 amino acid residues (S186, R301, T315, and Q1014) with direct hydrogen bonds to the phosphate backbone of the target DNA strand within a 3.0-Å distance at the proximal end of PAM were identified (S1 Fig). Among these 4 residues, both R301A and T315A exhibited a tendency for reduced cleavage activity at several mismatched sites compared to AsCas12a WT [39]. To study the effects of these mutations systematically, we constructed 4 single amino acid mutants by alanine substitution (S186A/R301A/T315A/Q1014A) and generated all possible double, triple, and quadruple versions by combining these mutations. Then, we employed a previously reported human cell-based enhanced GFP (EGFP) disruption assay to test their off-targeting [36]. The result showed that all 14 variants retained comparable on-target activities to AsCas12aWT when using the fully matched EGFP crRNA (Fig 1A). Next, we sought to evaluate the performance of these variants toward the imperfect crRNA-DNA matching. To do this, we repeated the EGFP disruption assay by combining all variants with EGFP-crRNA expression plasmids that contain 2 substituted bases at positions ranging from 15 to 23 (Fig 1A). We found that the nuclease activity of all triply substituted variants reduced dramatically when 2 adjacent crRNA-DNA base pair mismatches were located at the position from 15 to 19 (reduction ranges from 14.1% to 82.5%) (Fig 1A). Furthermore, the quadruple substitution variant (S186A/R301A/T315A/Q1014A, termed AsCas12a4m) presented the reduced cleavage efficiency ranging from 20.9% to 92.6% compared to AsCas12aWT (Fig 1A).

Modifying amino acid residues in close contact with the target DNA strand or non-target DNA strand might have various impacts on the cleavage activity at the target site [28]. To systematically determine the activity of AsCas12a4m at endogenous chromosomal sites, we compared the activity of AsCas12aWT and all substitution variants (including AsCas12a4m) at 16 endogenous sites using T7E1 (T7 Endonuclease I) assay in 293T cells (Figs 1B, 1C, S1 and S2). We found all variants retained highly comparable activities (90% to 115%) to AsCas12aWT at TTTV (V = A/G/C) PAM sites (Figs 1B and S1), and AsCas12a4m showed at least 90% of the on-target cleavage efficiencies observed with AsCas12aWT at the same sites (Figs 1C, 1D and S2). Based on the results, we selected the AsCas12a4m for the subsequent experiment.

For further investigating crRNA-DNA mismatch tolerance of AsCas12a4m in human cells, we arbitrarily selected 2 endogenous target sites (CFTR and B2M) and constructed a series of plasmids encoding crRNAs with 1 or 2 mismatches (Fig 2A and 2B). Firstly, we tested the activity of AsCas12aWT and AsCas12a4m guided by crRNAs with single mismatches along the protospacer complementarity region. For the CFTR site, AsCas12aWT showed 5.7% to 68.5% cleavage efficiency at mismatch positions 2, 3, 4, 6, 7, 9, 10, 11, and 13–23 (Figs 2A and S3). For the B2M site, AsCas12aWT presented 6.9% to 38.1% cleavage efficiency at mismatch positions 1, 8, 9, 10, 11, 13–16, and 18–23 (Figs 2B and S4), and did not tolerate single mismatches at positions 2–7 (Figs 2B and S4). Not surprisingly, the results demonstrated AsCas12aWT could mediate DNA cleavage with imperfect crRNA-DNA matching at positions 1 through 23, which were consistent with the previous studies [31]. However, for AsCas12a4m, no tolerance was detected for any single mismatches at positions 1–19 (Fig 2A and 2B). We also tested the editing of AsCas12aWT and AsCas12a4m at CFTR and B2M sites by using crRNAs with 2 adjacent mismatches (Fig 2A and 2B). The analysis showed that AsCas12aWT and AsCas12a4m processed nearly undetectable cleavage activities with 2 adjacent mismatches through positions 1–18 for both CFTR and B2M sites (except for AsCas12aWT at B2M 9 and 10 mismatch) (Figs 2A, S3 and S4). By contrast, mismatches (single mismatch or 2 adjacent mismatches) at positions 20–23 did not substantially reduce the cleavage activities for both AsCas12aWT and AsCas12a4m (Fig 2A and 2B). Overall, AsCas12a4m exhibited high sensitivity to crRNA-DNA mismatches in both CFTR and B2M sites especially for the close end region of PAM. The results suggested that AsCas12a4m may enhance the fidelity of gene editing.

To evaluate the fidelity of AsCas12a4m at endogenous sites in human cells, we used the GUIDE-seq method to assess the genome-wide specificity of AsCas12aWT and AsCas12a4m with 6 different crRNAs targeted to PD1, B2M, HPRT, DNMT1, CLIC4, and NLRC4. To test whether the double-stranded oligodeoxynucleotide (dsODN) tag was integrated into the on-target break site, we performed PCR reactions initiated by 1 primer that specifically annealed to the dsODN and another primer that annealed to the upstream or downstream of on-target break sites (S5 Fig). The dsODN tag was successfully integrated into double-strand breaks (DSBs) induced by AsCas12aWT and AsCas12a4m (S5 Fig). The GUIDE-seq analysis revealed that crRNAs targeting PD1 and B2M generated no unwanted mutations for AsCas12aWT and AsCas12a4m variant. crRNAs targeting HPRT, DNMT1, CLIC4, and NLRC4 generated 1, 10, 4, and 4 off-target sites for AsCas12aWT, respectively, while 0, 1, 1, and 2 off-target sites for AsCas12a4m, respectively (Figs 2C, 2D and S6). GUIDE-seq analysis of AsCas12a4m showed that the number of off-target sites decreased by lower than 3, the on-to off-target read ratio (range 2% to 25%) was improved, and the number of on-target reads still retained, compared to AsCas12aWT (Figs 2D and S6). To validate the off-target sites identified by GUIDE-seq, we confirmed the occurrence of indels using deep sequencing (S7 Fig). All results demonstrated that AsCas12a4m possesses higher fidelity than AsCas12aWT.

AsRVR and enAsHF1 have been reported to have a broader targeting range than AsCas12aWT [32,39], while altered PAM preferences might induce extra off-targets at the noncanonical PAM sites [36,40]. We sought to graft AsCas12a4m mutations onto AsRVR and enAsHF1 (AsRVR-4m, enAsHF1-4m) and tested whether these alterations would improve targeting specificity. First, we evaluated the editing activities of AsRVR-4m and enAsHF1-4m in endogenous human genes, and 15 endogenous genomic sites harboring TTTV, TTCV, TATG, TATC, GTTA, CTTA, and GTCA PAMs were selected for T7E1 assay (Figs 3A, 3B and S8). As a result, these mutations did not affect the cleavage activity at all of the tested sites (Fig 3A). Next, we performed crRNA-DNA tolerance assay, according to the previous method (Fig 3C and 3D). Indeed, AsRVR and enAsHF1 exhibited nuclease activity toward crRNA-DNA single mismatch (Figs 3C, 3D and S9), and AsRVR showed more sensitivity to crRNA-DNA mismatch at these sites, compared to enAsHF1 (Figs 3C, 3D and S9). By contrast, AsRVR-4m and enAsHF1-4m caused a significant decrease in the single mismatch cleavage, which was consistent with the above results (Figs 2A, 2B, 3C, 3D and S9).

To globally assess the editing specificity of AsRVR-4m and enAsHF1-4m, we performed GUIDE-seq analysis on 3 endogenous sites that were well studied previously [36,40]. As a result, AsRVR-4m has a dramatically lower number of off-target sites at HEK293 site 1, POLQ1, and POLQ2 (9, 0, and 18, respectively), compared with AsRVR (47, 12, and 77, respectively). Similarly, the number of off-target sites of enAsHF1-4m at the 3 sites (8, 1, and 22) were lower than those of enAsHF1 (36, 7, and 55, respectively) (Figs 3E and S10). On- to off-target read ratios of AsRVR-4m and enAsHF1-4m at HEK293 site 1, POLQ1, and POLQ2 significantly increased (57.3%, 100%, and 19.7% for AsRVR-4m and 29.8%, 90.5%, and 19.1% for enAsHF1), compared with AsRVR and enAsHF1(9.6%, 45.6%, 5.8% and 7.5%, 43.6%, 13.3%, respectively) (Fig 3E–3I). We performed deep sequencing to validate the off-targets sites identified by GUIDE-seq (S11 Fig). As expected, the 4m variant has significantly improved the specificity and dramatically reduced the off-target index (0.67 and 0.65 for AsRVR and enAsHF1, for at canonical TTTV PAM, 0.83, and 0.72 for AsRVR and enAsHF1 at noncanonical PAM) (Fig 3G and 3I).

The cleavage activity of AsCas12aWT nuclease was reported to be nearly unaffected by the mismatches in the PAM distal bases between 18 and 23 [9,31]. We also confirmed it by the T7E1 assay (Fig 2A and 2B). To systematically evaluate the effect of the PAM distal bases, we constructed crRNA expression plasmids containing all possible pairs of the mismatched bases between 14 and 23 within the complementarity regions of crRNAs targeted EGFP and repeated EGFP disruption assay. In line with our former experiments (Fig 2A and 2B), the AsCas12a4m variant showed the high sensitivity to mismatched crRNA nucleotides in most places (Fig 4A). However, both AsCas12aWT and AsCas12a4m could mediate enough EGFP disruption when mismatched at the PAM distal positions (Fig 4A). GUIDE-seq analysis for AsCas12aWT and AsCas12a4m were further performed at another well-studied endogenous sites RPL32P3 in 293T cells (Figs 4B and S12). To confirm these GUIDE-seq findings, we used T7E1 assay to assess the frequencies of indel mutations induced by AsCas12aWT and AsCas12a4m at 4 off-target sites (Figs 4C and S12). In detail, at the off-target sites 3 and 4, the dsDNA cleavage events were 15% and 17% for AsCas12aWT, respectively, and nearly not detected for AsCas12a4m (Fig 4C). However, both AsCas12aWT and AsCas12a4m showed enough cleavage events at the off-target sites 1 and 2 (23%, 31%, and 20%, 16% cleavage efficiency for AsCas12aWT and AsCas12a4m at off-target sites 1 and 2, respectively) (Fig 4C). The results indicated that: (1) AsCas12a4m-induced dsDNA breaks with high fidelity; and (2) AsCas12a4m was not sensitive to mismatches positions in the PAM distal regions.

To further improve the fidelity in the PAM distal regions, it was initially hypothesized that the unwanted off-targeting with mismatch positions in the PAM distal regions might be minimized by decreasing nonspecific interactions with the 3′ ends of the guide RNA and the 5′ ends of the target DNA. Based on the crystal structure of AsCas12a in complex with crRNA and target DNA [38], we selected 3 residues (K414, Q286, and W382) and 1 residue (S376) that made direct contacts to 3′ ends of the guide RNA and the 5′ end of the target DNA for alanine substitution (Figs 5A and S13A–S13C). Then, the on-target activity of 4 mutants over 6 target sites with TTTV PAM sequence were evaluated. As shown in Fig 5A, single residue substitutions, except for the W382A hardly perturbed the editing efficiencies at target sites. To evaluate the performance of all possible mutant versions, we performed the T7E1 assay. On-target activity and 4 off-targets activities of all mutant versions were evaluated at the RPL32P3 target site in 293T cells. For the on-target site, we observed that the indels caused by AsCas12a4m-K414A, AsCas12a4m-S376A, and AsCas12a4m-Q286A mutant were about 32%, 35%, and 31%, respectively, compared to AsCas12aWT, 35% and AsCas12a4m, 33% (Figs 5B and S13D). By contrast, other combinations dramatically decreased the activity (Figs 5B and S13E). In addition, deep sequencing analysis showed that AsCas12a4m-K414A keep highly comparable activities (80% to 100%) to AsCas12aWT (S14 Fig). Indels events did not happen for AsCas12aWT and all As mutants at the off-targeting sites, except AsCas12aWT at the off-target 3 and 4. Furthermore, AsCas12a4m-K414A (termed HyperFi-As) and AsCas12a4m-Q286A were revealed to have the lower off-target rates at the off target 1 and 2 (Figs 5B and S13D). Although further proof of GUIDE-seq analysis indicated that HyperFi-As increased the off- to on-target read ratio at off-target 1, the number of total off-target sites decreased by 13 compared to AsCas12a4m-Q286A (Figs 5C, 5D, S12C, and S12D). We further selected SIPRa, a well-studied target site to perform GUIDE-seq analysis for specificity assessment [41]. The result demonstrated that targeting SIPRa showed off-target activity for HyperFi-As at 3 loci, which was less in number than 49, 9, and 7 for AsCas12aWT, AsCas12a4m, and AsCas12a4m-Q286A, respectively (Fig 5E and 5F). In addition, statistics of the GUIDE-seq reads revealed that HyperFi-As possessed the lowest percentage of off-targets with mismatches in the PAM distal region among As, AsCas12a4m, HyperFi-As, and AsCas12a4m-Q286A (Fig 5F).

To systematically compare the specificity of HyperFi-As with other recent high-fidelity AsCas12a variants and SpCas9 variants, we comprehensively assessed these variants’ capability to reduce genome-wide off-target effects of gRNAs designed against target sites with a large number of homopolymeric sequences in human cells. For the PPP1R13L site, HyperFi-As exhibited a reduced number of off-target sites compared to As variants, and the percentage of on-target was also the highest among variants (Figs 5G and S15). To further confirm it and compare the genome-wide specificities of CRISPR-Cas nucleases including AsCas12aWT, As ultra, As plus, SpCas9, and SuperFi-SpCas9, we repeated GUIDE-seq with 5 gRNAs targeting sites containing overlapping sequences (HEK293 site 2/3/4/5/6) (Figs 5H and S16–S20). For 5 sites, the high-fidelity variants such as As plus and SuperFi-SpCas9 exhibited improved specificity (Fig 5H), which was consistent with previous reports [33,35,42,43]. However, no on-target gene editing events were detected at the HEK293 site 2/4/6 for SuperFi-SpCas9 (S16, S18 and S20 Figs). Notably, HyperFi-As showed the best specificity among the 6 tested variants of AsCas12a and SpCas9 (Figs 5H and S15–S20).

To explore whether HyperFi-As has better specificity to distinguish the mutant DNA sequence and thus possibly decreases the off-target efficiency, we compared the stability of DNA-Cas12a-crRNA complexes that containing the HyperFi-As and AsCas12aWT on various mutant DNA sequences using single-molecule DNA unzipping experiments, according to the previous study for determining the stability of DNA-Cas12a-crRNA [44]. However, a proper constant force was used instead for sensitive detection. In the end, the life-time of the intermediate states during the disassembly sensitively detects multiple states by this modified new way.

We constructed a series of 34-bp DNA hairpins containing the PAM and various target/off-target sequences (Figs 6A and S21A) as the substrates. We stretched the hairpin between a paramagnetic magnetic bead and a glass slide through 2 dsDNA handles. In the force-increasing scan at the loading rate of 1 pN/s, the naked DNA hairpin unzipped at approximately 18 pN, while a high force of approximately 30 pN was required to completely unzip the DNA-Cas12a-crRNA complex (S21B Fig). Note that we used the dead mutants of AsCas12a without cleavage activity and the DNA hairpins were protected.

To determine the stability and possible multiple states of each kind of DNA-Cas12a-crRNA complex, we elevated the force from 5 pN to 26 pN and held the force at 26 pN for 120 s (Fig 6B). The measurements were repeated at least 20 times for each molecule, and the results from multiple molecules were yielded. The transient R-loop complex state as the first of 3 states was sensitively detected and 2 steps was illustrated to completely unzip the hairpin that bound crRNA-Cas12a (Fig 6B). Based on the increases in DNA extension, the first step represents the dissociation of the non-target sequence from the R-loop complex, and the second step represents the unzipping of PAM (Fig 6C). The difference between states 1, 2, and 3 is the length of the non-target sequence bound to Cas12a. In state 1, the Cas12a-crRNA-DNA complex forms a tight binding, encompassing both the target sequence and the non-target sequence. State 2 represents a partial dissociation of the Cas12a-crRNA-DNA complex, with the non-target strand upstream of the PAM being released from the R-loop complex. In state 3, the hairpin downstream of the PAM, including the PAM sequence, unfolds under force and is released from the Cas12a-crRNA complex. The transition from state 1 to state 2 indicates the non-target strand upstream of the PAM moving away from the R-loop complex while the transition from state 2 to state 3 indicates the unfolding of the hairpin strand downstream of the PAM including the PAM sequence. The stabilities of the complexes that had the same crRNA but with 3 different DNA sequences (the WT target and 2 real off-target DNA subtracts) were compared. When bound to the on-target, the instability of DNA-Cas12a-crRNA were similar for both HyperFi-As and AsCas12aWT. However, when bound to the off-target, the instability was more affected and increased a lot for HyperFi-As (Fig 6D), which was consistent with the result that HyperFi-As had the similar gene editing efficiency at on-target sites but a lower tolerance for off-target sites than AsCas12aWT. Detailed analysis of the unzipping assay revealed that HyperFi-As was largely less distributed at the first state when bound to the off-target sites (Fig 6E), which might suggest more dissociations of the non-target sequence from the R-loop complex for HyperFi-As. All these shed important insights on how HyperFi-As could behave in the single-molecule level and lead to low off-targeting.

All plasmids and guide RNAs used in this study can be found in S1 Table. AsCas12a human expression plasmid pY010 was purchased from the nonprofit plasmid repository Addgene (Addgene plasmids #69982). All AsCas12a variants were generated by standard site-directed mutagenesis. In brief, using AsCas12a plasmid pY010 as the template and a pair of primers that one primer carrying site mutation nucleotide to amplify 500 bp fragments by PCR (Phanta MAX Super-Fidelity DNA Polymerase P505, Vazyme). After confirming that the bands were correct by agarose gel electrophoresis, the PCR products were purified. Next, taking 1,000 ng PCR products as the circling mutation primers and 100 ng AsCas12a plasmid pY010 as template to carry out PCR again. PCR products were purified and use DpnI to digest the original template at 37°C for 1 h, inactivated at 80°C for 20 min, take 10 μl digested products for transformation. The next day, single colonies were sent for sequencing. Oligonucleotide duplexes corresponding to spacer sequences were PCR amplified and cloned into pU6-As-crRNA plasmids (Addgene plasmids #78956) for U6 promoter-driven U6 promoter-driven transcription of As crRNAs (ClonExpress II One Step Cloning Kit C112, Vazyme).

The HEK293T cells maintained in DMEM medium supplemented with 10% fetal bovine serum and 100 units mL⁻¹ penicillin, 100 μg mL⁻¹ streptomycin sulfate (all cell culture products were obtained from Gibco) at 37°C in 5% CO₂. For plasmid-based genome editing, approximately 1.2 × 10⁵ cells were seeded into per well of 24-well plate a day before transfection, 600 ng Cas12a and 300 ng crRNA expression plasmids were transfected into cells using Hieff Trans Liposomal Transfection Reagent (CAT:40802ES03, Yeasen, Shanghai).

For EGFP disruption analysis in HEK293T cells, approximately 2.4 × 10⁴ cells were seeded into per well of a 96-well plate a day before transfection, a total of 100 ng of Cas12a plasmid, 30 ng crRNA expression plasmids, and 30 ng EGFP expression plasmids were transfected into HEK293T cells. A U6 promoter-driven empty plasmid for the substitution of crRNA expression plasmid as a negative control, and 48 h post-transfection, cells were analyzed on the CytoFLEX (Beckman Coulter).

Approximately 48 h post-transfection, cells were collected by centrifugation and the supernatants were removed. The 50 μl Lysis buffer and 0.5 μl Proteases were mixed with cells and incubated at 55°C for 30 min, 95°C for 30 min (Animal Tissue Lysis Component, CAT: 19698ES70, Yeasen, Shanghai). The genomic region flanking the CRISPR target site for each gene was amplified by PCR with Phanta MAX Super-Fidelity DNA Polymerase P505 (Vazyme) using 1 μl cell lysis as template and the primers listed in S1 Table. PCR products were purified and the concentrations were determined; 250 ng of purified PCR products were mixed with 1 μl 10×T7E1 buffer (Vazyme) and ultrapure water to a final volume of 10 μl, and subjected to a re-annealing process to enable heteroduplex formation: 95°C for 3 min, 95°C for 30 s, 90°C for 30 s, 85°C for 30 s, 80°C for 30 s, 75°C for 30 s, 70°C for 30 s, 65°C for 30 s, 60°C for 30 s, 55°C for 30 s, 50°C for 30 s, 45°C for 30 s, 40°C for 30 s, 35°C for 30 s, 30°C for 30 s, and 25°C for 1 min. After re-annealing, products were treated with T7 Endonuclease I (EN303-01/02, Vazyme) for 15 min at 37°C. The reaction mixtures were run on 2% agarose gels and imaged with ChemiDoc XRS+ and analyzed according to strip intensities. Indel percentage was determined by the formula: 100 × (1 –sqrt (b + c)/(a + b + c)), where a is the integrated intensity of the undigested PCR product and b and c are the integrated intensities of the cleavage product.

Briefly, 600 ng Cas12a, 300 ng crRNA expression plasmids, and 10 pmol of the dsODN GUIDE-seq tag were transfected into a 24-well 293T cells (1.2 × 10⁵ cells per well); 48 h after transfection, the genomic DNA was harvested and purified using FastPure Cell/Tissue DNA Isolation Mini Kit DC102 (Vazyme). GUIDE-seq tag integration percentages and on-target modification were assessed by restriction-fragment length polymorphisms (RFLPs) assays and T7E1 assays (as described above), respectively. A total of 1,000 ng genomic DNA was fragmented, end repaired, A-tailing by using Hieff NGS Fast-Pace DNA Fragmentation Reagent (12609ES96, Yeasen, Shanghai). The sequencing library was prepared and sequenced on an Illumina Instrument and data was analyzed using guideseq v1.1 as described previously.

To detect the expression of As variants, cells were collected and lysed after 48 h transfection. Lysates were resolved through SDS-PAGE electrophoresis and transferred onto a polyvinylidene fluoride membrane (Millipore, United States of America). Membranes were blocked by blocking buffer (5% non-fat milk in Tris buffered saline with Tween20 (TBST)) for 2 h. Blots were incubated with HA Mouse primary antibody (CAT#901515, Biolegend, USA) at 1:20,000 dilution and β-actin Rabbit primary antibody (CAT#AC026, ABclonal, China) at 1:20,000 dilution for 3 h at room temperature, respectively. After washing steps in TBST, membranes were incubated for 1 h with HRP Goat anti-Mouse IgG (H+L) for HA (CAT#AS003, ABclonal, China) and HRP Goat anti-Rabbit for β-actin (CAT#AS014, ABclonal, China) at 1:50,000 dilution, respectively.

The hairpin region contains the PAM and protospacer in the center, schematic of the single-molecule substrate is available in S21C Fig.

All oligonucleotides were purchased from Sangon Biotech. The tethered DNA substrate was a molecule comprised of a 34-bp hairpin region, a 5-nucleotide loop, and 2 dsDNA handles, 630 bp and 653 bp, allowing attachment to the glass coverslip and the magnetic bead, respectively. The main step of hairpin construction is showed as follow:

We synthesized all the oligos with the following sequences (Sangon Biotech).

hairpin-biotin: bio-ATTTACGCCGGGATATGTCAAGC

hairpin_F1: ATTTACGCCGGGATATGTCAAGCCGAAGCATGAAGTG

hairpin_upR1: TCTGATGGTCCATACCTGTTACACTGCCTGAATGCAGCCATAGGTGC

hairpin_upR2: TGAGGTCTCAAGAAAAACTCACGACGCTTTCTGATGGTCCATACCTGTT

hairpin_upR3: CTGAATGCAGCCATAGGTGC

hairpin-sh: SH-AGTCAGTTGCATCAGTCACAAGGG

hairpin_R1: AGTCAGTTGCATCAGTCACAAGGG

hairpin_downF3: CAGGTATACAGATTAATCCGGC

hairpin_downF1: CATACCTGTTACACTGCCTGAATGCCAGGTATACAGATTAATCCGGC

hairpin_downF2: TGAGGTCTCATTCTCACGACGCTTTCTGATGGTCCATACCTGTTACACTGCCTGA

We used a homemade magnetic tweezers setup to stretch individual DNA molecule, which was described previously [54]. We functionalized the coverslips with (3-aminopropyl) triethoxy silane (APTES, Sigma-Aldrich), which allowed the 5′-thiol end of each DNA molecule to attach to the amine group of APTES via Sulfo-SMCC crosslinker (Hunan Huteng). We attached streptavidin-coated paramagnetic beads (Dynal M270, Thermo Fisher Scientific) to the 5′-biotin end of the DNA molecules. We mixed crRNA and Cas12a at 37°C for 20 min in advance and added 10 nM Cas12a-crRNA complexes into the flow cell to form DNA-Cas12a-crRNA complexes. Magnetic tweezers measurements were collected at room temperature (21 to 23°C) in 10 mM Tris-HCl (pH 7.5), 150 mM KCl, and 0.1 mg/ml BSA buffer.

All statistical analyses were performed using GraphPad Prism (v.8.2.1). The exact replication numbers are indicated in the figure legends. The reproducibility was shown by performing at least 2 independent biological replicate experiments.