A system for making and processing guide RNA to improve CRISPR gene editing and silencing in Candida tropicalis

Utilizing tRNAscan-SE software (30), the whole genome of C. tropicalis was searched for tRNA-coding sequences. After excluding eight pseudogenes, we obtained 20 types of tRNAs related to transporting different amino acids in different quantities. In addition, among the various tRNAs, some were predicted to contain introns in the coding sequence (Fig. 1A). The six types of tRNAs predicted without introns were tRNA^Ala, tRNA^Gly, tRNA^Val, tRNA^Met, tRNA^Gln, and tRNA^Asp. Since the tRNA^Gly sequences lack introns and are short in length, they are suitable as RNA Pol III promoters. Therefore, we aligned the 17 sequences of the endogenous tRNA^Gly in C. tropicalis ATCC 20336, together with publicly available tRNA sequences of C. tropicalis MYA 304 and C. tropicalis 121 (see Fig. S1 in the supplemental material). Interestingly, we found that some of the C. tropicalis tRNA^Gly sequences were highly similar. Since we aimed to develop a tRNA able to serve as a potential promoter for transcription and processing of multiple gRNAs from one array, the secondary structure was also analyzed with tRNAscan-SE (30). Comparing the C. tropicalis tRNA^Gly (Fig. 1B) with the previously reported tRNA^Gly in Y. lipolytica (31) and rice (25), even though the sequences are quite different, the nucleotides close to the ribozyme cleavage sites are the same (Fig. 1C). As the ribozyme cleavage sites of the tRNA^Gly sequences were confirmed in other studies, we concluded that the ribozyme cleavage sites were consistent in the coding sequences of tRNA^Gly.

To verify the availability of the candidate tRNA^Gly, we fused a transient CRISPR-Cas9 cassette with the tRNA:gRNA array targeting URA3 (ptsgURA3) (Fig. 2A, Fig. 3A, and Sequence S1). The final Cas9-ptsgURA3 construct and the donor were transformed into C. tropicalis ATCC 20336. The donor was designed to carry an EcoRI restriction site and contained 50-bp homologous regions upstream and downstream of URA3. One hundred transformants on the screening plate were verified by PCR and EcoRI digestion. For this, the genomic DNA of the colonies was isolated and used as the template in PCR using the primers URA3-F and URA3-R (Table S2). The results of EcoRI digestion and sequencing showed that URA3 was successfully edited in all colonies in three independent experiments.

After demonstrating adequate efficiency for single-gene editing, the tRNA:gRNA platform was tested for multi-gene editing. We constructed the tRNA:gRNA platform targeting GFP3 and URA3, paying particular attention to the junction of the gRNAs (Fig. 2B, Fig. 3B). More precisely, the polyU tail in the gRNA scaffold was removed between the consecutive gRNAs, based on an effective design for tRNA-gRNA direct fusions for gene editing in Y. lipolytica (31). The transformants on the screening plate were verified by PCR using primers URA3-F, URA3-R, GFP3-F, and GFP3-R listed in Table S2. EcoRI digestion, HindIII digestion, and DNA sequencing analysis were performed for assessing multi-gene editing efficiency (Fig. S2). At first, transformation of the two donors and the tRNA:gRNA platform reached only a 5% knockout efficiency for both genes. The donors were then fused to the termini of the tRNA:gRNA platform to enhance the editing rate (Fig. 2B), and 71.0 ± 4.8% of C. tropicalis GU colonies were correctly edited in the genome (Table 1).

To implement the CRISPRi system in C. tropicalis, a synthetic Cas9 gene, based on the Cas9 gene from Streptococcus pyogenes, was inactivated by amino acid point mutations (dSpCas9, N10A, and H840A) (11). The 3′ terminus of dSpCas9 was appended with a triple repeat of the SV40 nuclear localization signal, and the expression cassette consisted of the strong constitutive GAP1 promoter and the ENO1 terminator (32). The expression cassette was transformed into C. tropicalis Cu-206 to generate C. tropicalis D1. Since it was verified that the GAP1 promoter supported high expression of genes in our previous work (32), we further transformed the reporter GFP3 cassette with a GAP1 promoter in the present work. The resulting strain was named C. tropicalisGFP3 interference 0 (Gi0), and dSpCas9 expression hardly affected the growth of C. tropicalis (Fig. S3).

Since the expression of both dSpCas9 and GFP3 depend on the strong constitutive GAP1 promoter, the designed targeting region should be within the coding sequence (CDS) instead of the promoter sequence of GFP3 to avoid disturbing the expression of dSpCas9. Four different regions in the CDS of GFP3 were selected, based on which complementary gRNAs were generated (Fig. 4A): GiA (+6), GiB (+48), GiC (+96), and GiD (+249). The first nucleotide of 5′-N20 targeting sequences in GFP3 (Table. S1) was marked to show the distance from the translation initiation codon (ATG) (Fig. 4A). After integrating the GFP3 interference (Gi) cassette into the POX5 locus in the genome, the green fluorescence intensity of the control (C. tropicalis Gi0) was stronger than that of the others, as observed by fluorescence microscopy (Fig. 5).

To gain an insight into the exact fluorescence of the mutants, the mean fluorescence intensity (MFI) of the single yeast cell was determined by flow-cytometry analysis. The relative MFI values of C. tropicalis GiA, C. tropicalis GiB, C. tropicalis GiC, and C. tropicalis GiD were 34.3 ± 0.5%, 39.1 ± 1.0%, 37.0 ± 0.1%, and 38.1 ± 0.4%, respectively. The relative expression levels of GFP3 were measured further (Fig. 4B). The GFP3 expression level in C. tropicalis GiA was repressed to 23.9% ± 4.1%, and in the other strains, the values were similar (Fig. 4C). Thus, it was confirmed that the CRISPRi system in C. tropicalis could repress the expression of exogenous genes. Selection of the CDS region proved reliable for achieving relatively high suppression.

We investigated whether the targeting sites upstream and downstream of the translation initiation codon (ATG) were both available for regulating the target genes. ADE2, an important gene in the adenine biosynthesis pathway, was selected as the endogenous reporter gene. The promoter and the coding region of the endogenous genes in diploid yeast differed to various extents. We first knocked out one copy of ADE2 in C. tropicalis D1, and the other copy was maintained, generating the C. tropicalis strain Da. Eight different regions in ADE2 were chosen to design gRNAs (Fig. 6A): AiA (+164), AiB (−119), AiC (−212), AiD (+286), AiE (−19), AiF (−150), AiG (−195), and AiH (−345). The detailed targeting sequences are listed in Table S1. Quantitative real-time PCR (qRT-PCR) was used for the measurement of downregulation of ADE2 (Fig. 6B). The regions AiC and AiG achieved obvious downregulation, with relative expression levels of 39.5 ± 1.5% and 38.0 ± 7.4%, respectively. However, in C. tropicalis AiF, there was no obvious downregulation of ADE2. For the other targeted regions, the relative expression levels ranged from 62.8 ± 3.0% (AiH) to 82.7 ± 3.1% (AiD). Thus, the promoter region in C. tropicalis is suitable for flexible regulation in the CRISPRi system.

To further analyze whether adenine biosynthesis was affected, the cell density (optical density at 600 nm [OD₆₀₀]) of C. tropicalis mutants in which ADE2 was downregulated was measured every 3 h. The growth curves of C. tropicalis mutants showed that silencing of ADE2 resulted in growth suppression (Fig. 6C). The growth rate was in accord with the ADE2 expression level, and C. tropicalis AiG grew slowest in the first 12 h among the nine strains. On the MM plate, the colony of C. tropicalis AiG appeared smaller than that of C. tropicalis Ai1 (Fig. S4).

In a previous study, a heterologous β-carotene synthetic pathway was constructed in C. tropicalis DRPB (32). In the metabolic pathway, GGPP (geranylgeranyl diphosphate) is a common precursor of diterpenoids, and its accumulation reflects terpene production. The sterol biosynthesis pathway is the major farnesyl pyrophosphate (FPP)-consuming pathway in S. cerevisiae, and knockdown of squalene synthase-encoding gene ERG9 increased production of carotenoid (33). In C. tropicalis DRPB, we aimed to reduce the transcription level of ERG9 using the CRISPRi system, in order to explore the influence of ERG9 on β-carotene production (Fig. 7A). Based on valid targeting regions of the genes GFP3 and ADE2, we selected three targets on ERG9: EiA (+20), EiB (−41), and EiC (+130). The expression cassette was integrated at the CAT locus (Fig. S5). The strain C. tropicalis DRPB was chosen as the control. From the qRT-PCR results, the relative transcription levels of ERG9 were 74.1 ± 3.2%, 23.1 ± 4.7%, and 32.3% ± 1.5%, in C. tropicalis EiA, C. tropicalis EiB, and C. tropicalis EiC, respectively (Fig. 7A). Next, we analyzed the β-carotene production ability of each strain using high-performance liquid chromatography (HPLC). As shown in Fig. 7B, β-carotene reached 0.42 ± 0.02 mg/g of dry cell weight in C. tropicalis EiB. In C. tropicalis EiA and C. tropicalis EiC, β-carotene reached was 0.21 ± 0.05 and 0.26 ± 0.02 mg/g of dry cell weight, respectively. Comparing the yield of β-carotene with the relative transcription levels, we found that the strain with the lowest expression of ERG9 accumulated the highest yield of β-carotene. Results in Pearson test showed that the yield of β-carotene and the relative expression level of ERG9 were negatively related (r = −0.820, P < 0.05). The knockdown of ERG9 enhanced the accumulation of β-carotene in C. tropicalis. Additionally, this confirmed that the CRISPRi system could be used for metabolic engineering of C. tropicalis.

Plasmids and strains used in this work are listed in Table 2. All plasmids were constructed in Escherichia coli JM109. Media for cultivating C. tropicalis cells were as follows: minimal medium (MM) contained 6.7 g/L yeast nitrogen base, 20 g/L glucose, and 10 g/L (NH₄)₂SO₄, supplemented medium (SM) was supplemented with 0.06 g/L (wt/vol) uracil and based on MM. Fluoroorotic acid SM (FOA-SM) was supplemented with 2 g/L (wt/vol) 5-fluoroorotic acid and based on SM, yeast peptone dextrose (YPD) medium contained 20 g/L (wt/vol) glucose, 20 g/L (wt/vol) peptone, and 10 g/L (wt/vol) yeast extract, and 2× YPD medium contained 40 g/L (wt/vol) glucose, 40 g/L (wt/vol) peptone, and 20 g/L (wt/vol) yeast extract.

tRNAscan-SE (30) was used for searching and subsequent analysis of tRNAs in C. tropicalis ATCC 20336. Genome information was obtained from our previous study (32). The endogenous tRNA^Gly and the 300-bp upstream sequence were obtained as the RNA Pol III promoter for producing gRNAs and were applied in both CRISPR-Cas9 and the CRISPRi system in this work.

The tRNA^Gly and the 300-bp sequence upstream of tRNA^Gly were amplified from the genome of C. tropicalis ATCC 20336. The tRNA:gRNA platform targeting URA3, ptsgURA3, was chemically synthesized (Genewiz, Suzhou, China). Other gRNA expression plasmids were derived from the plasmid ptsgURA3 by PCR.

For the single-gene disruption, the Cas9 expression cassette was obtained by digesting plasmid PHCU06 (32) with restriction enzyme SpeI. The ptsgURA3 fragment was obtained by digesting plasmid ptsgURA3 with restriction enzyme SpeI. Cas9-ptsgURA3 was constructed by ligation of the above two fragments using DNA ligation kit (TaKaRa, Dalian, China). For the multi-gene disruption, plasmid ptsgGU and the tRNA:gRNA platform were constructed from the plasmids ptsgGFP3 and ptsgURA3 using a one-step cloning kit (Vazyme, Nanjing, China). The selection of gRNAs and the construction of donors were performed according to our previous study (40). N20 sequences were selected by the bioinformatics tool sgRNACas9 (32, 40).

Verification of the tRNA^Gly availability was performed using the transient Cas9 expression cassette fused with the ptsgURA3 fragment. The final Cas9-ptsgURA3 construct and the donor were transformed into C. tropicalis ATCC 20336. The donors contained a stop codon and 50-bp homologous regions upstream and downstream of the cleavage sites in URA3 (orotidine monophosphate decarboxylase) and GFP3, respectively. The donor of URA3 was inserted into the EcoRI restriction enzyme, and the donor of GFP3 was inserted into the HindIII restriction enzyme site. The donor was obtained by PCR using each pair of equimolar diluted DNA primers. Primers for the donor of URA3 and GFP3 for homology-directed repair (HDR) are listed in Table S2. To explore the functions of the tRNA:gRNA platform, the fragment of the array flanked with the donors was transformed into C. tropicalis GU, which was integrated with GFP3 and URA3 at the POX5 (acyl coenzyme A oxidase I) locus. The editing rates were calculated from three independent experiments.

With the aid of tRNAs, we constructed the CRISPRi system by choosing C. tropicalis Cu-206 as the chassis cell and integrated dSpCas9 at the CAT locus. We further expressed GFP3 at the POX5 locus to assess the efficiency of the CRISPRi system in C. tropicalis D1. In the control stain C. tropicalis Gi0, GFP3 was expressed utilizing a GAP1 promoter, while gRNA expression cassettes fused to the terminator of GFP3 were expressed in C. tropicalis GiA, GiB, GiC, and GiD. For assessing ADE2 regulation efficiency, the construction steps for gRNA expression cassettes were similar, except that a copy of ADE2 was knocked out in C. tropicalis D1. All expression cassettes were flanked with the MluI restriction enzyme for digestion. DNA fragments were purified by the ethanol precipitation method. Yeast transformation employed the lithium chloride protocol, and the selection marker URA3 was recycled after each transformation (41). C. tropicalis is a diploid yeast, and all expression cassettes were integrated at a single locus, which was verified by PCR and DNA sequencing analysis.

Recombinant strains expressing GFP3 were cultivated until reaching an OD₆₀₀ of 10 in 20 mL YPD medium and then inoculated into fresh synthetic medium with an initial OD₆₀₀ of 0.05 in 50 mL YPD. Cells at a final OD₆₀₀ of 2 to 3 were pelleted by centrifugation, washed twice with phosphate-buffered saline (PBS), and resuspended in PBS at an optimal density. Fluorescence images were obtained by a Nikon Eclipse 80i microscope (Nikon Corp., Tokyo, Japan) equipped with a blue laser (488 nm excitation, 530 nm emission).

Recombinant strains expressing GFP3 were cultivated until reaching an OD₆₀₀ of 10 in 20 mL YPD medium and then inoculated into fresh synthetic medium with an initial OD of 0.05 in 50 mL YPD. Cells at a final OD₆₀₀ of 2 to 3 were pelleted by centrifugation, washed twice with phosphate-buffered saline (PBS), and resuspended in PBS at an optimal density. Mean fluorescence intensity (MFI) was measured by a BD FACSAria III instrument (Becton, Dickinson and Company, Shanghai, China) with a blue laser (488 nm excitation, 530 nm emission).

C. tropicalis cells at an OD₆₀₀ of 1.5 to 2.5 were collected from the YPD fermentation broth, and total RNAs were isolated using a yeast RNAiso kit (TaKaRa, Dalian, China). RNA samples were further transcribed into cDNA with a PrimeScript RT reagent kit and gDNA eraser (TaKaRa, Dalian, China) following the manufacturer’s instructions. To determine the relative expression levels via quantitative PCR (qPCR), the housekeeping gene ACT1 (accession no. FM864204.1↗) was used as a control. All qPCR experiments were carried out with a SYBR premix Ex Taq kit (TaKaRa, Dalian, China) and a CFX96 real-time PCR system (Bio-Rad, CA, USA). Primers for ACT1, GFP3, and ADE2 were CTTACGAATTGCCAGATG (qACT1-F), CTTACGAATTGCCAGATG (qACT1-R), GACACAACATTGAAGATGGT (qGFP3-F), GCAGATTGAGTGGATAAGTAAT (qGFP3-R), CCAGAATCTTGAAGCAGTT (qADE2-F), and CAGCACCAGCAATGATAC (qADE2-R).

Recombinant strains accumulating β-carotene were cultivated to an OD₆₀₀ of 15 to 20 in 15 mL YPD medium and then inoculated into fresh synthetic medium to an initial OD of 0.1 in 15 mL YPD. After being cultivated for 96 h, two 1.5-mL samples of fermentation broth were collected by centrifugation and washed twice using double-distilled water (ddH₂O). The cellular precipitate from one sample was dried for measuring dry cell weight. The second sample was mixed with 1 mL 3 M HCl and boiled for 3 min, and the cell precipitate was collected by centrifugation (8,000 rpm) and washed with ddH2O. After being mixed with 1 mL acetone, cells were collected by centrifugation for 10 min (8,000 rpm). The supernatant liquid served as β-carotene extracting solution and was subjected to high-performance liquid chromatography (HPLC) analysis. Concentrations of β-carotene in culture broths were analyzed by Agilent 1260 Infinity (Agilent Technologies, Wilmington, USA) coupled with UV detection. Mobile phases A, B, and C were 35% methanol, 35% acetonitrile, and 30% ethyl acetate in water, respectively. The flow rate of the mobile phases was 1 mL/min, and the column temperature was 25°C. UV wavelength was 450 nm.