Heterozygous expression of the Alzheimer’s disease-protective PLCγ2 P522R variant enhances Aβ clearance while preserving synapses

hiPSC line BIONi10-C (Bio Sample ID: SAMEA3158050, ECACC ID:66,540,023) was purchased from EBiSC, which was deposited by Bioneer, and is available for research from European Collection of Authenticated Cell Cultures (ECACC). The PLCγ2 WT locus was authenticated through sequencing (Supplementary Table 1) and the PLCγ2^HET and PLCγ2^HOM hiPSC lines were generated on the parent BIONi10-C WT background in house using CRISPR editing. hiPSCs were cultured on Geltrex coated (100X) (A1413202, Gibco) plates and maintained at 37 °C and 5% CO₂ in E8-Flex medium (A2858501, ThermoFisher).

In brief, to insert the P522R variant, BIONi010-C WT hiPSCs were dissociated to single cells using StemPro™ Accutase™ (A1110501, ThermoFisher). Cells were then seeded at 5X10⁵ per well of a 6-well plate and incubated for 3–4 h to allow for attachment. sgRNA complex was prepared by mixing 100 µM stock of trcrRNA (1072532, IDT) and crRNA (sequence—CCTACAGAACTACATTTTGG), targeting exon 17 of the PLCγ2 locus, in equimolar concentration with 196 µL of nuclease free duplex-buffer (IDT) to a final volume of 200 μL and annealing at 95 °C for 5 min. At the same time, 1 µM stock Cas9 RNP was made by adding 1 µL of 62 µM Hi-Fi Cas9 RNP (1081060, IDT) to 61 µL of Opti-MEM™ (31985070, ThermoFisher). 12 µL of sgRNA complex and 12 µL of Cas9 RNP were then mixed in 76 µL of Opti-MEM and incubated at room temperature for 5 min. In parallel, 4 µL of Lipofectamine™ Stem (STEM00008, ThermoFisher) and 96 µL of Opti-MEM were mixed and incubated for 10 min at room temperature to make the transfection mixture. 2 µg of donor plasmid and 500 ng of puromycin selection construct were added to the sgRNA:Cas9 (RNP) complex and transfection mixture to a final volume of 200 µL, and incubated for 10 min. The medium on the plated cells was replaced with 2 mL of pre-warmed Opti-MEM supplemented with RevitaCell™ (100X) (A2644501, ThermoFisher) and transfection mix was added on top in a drop-wise manner before mixing gently through swirling the plate. Cells were left for 4 h in the incubator before medium top-up with E8-flex supplemented with RevitaCell and then being left on overnight. Medium changes were performed until cells reached 70–80% confluency, whereafter single cell selection with 0.25 μM Puromycin (A1113803, ThermoFisher) was done to isolate pure colonies. Single cell colonies were established, expanded and banked. To confirm conversion of 522P to 522R, DNA was extracted using DNeasy Blood & Tissue (69506, QIAGEN) and sent for sequencing (Eurofins Genomics) (sequencing primers are available in supplementary methods Table 1) and positive colonies were identified to be used in downstream assays.

Microglia-like cells were generated following Haenseler et al. [19]. In brief, embryonic bodies (EBs) were formed through plating and spinning of 3X10⁶ BIONi010-C (BINI-10) (WT, PLCG2^HET and PLCG2^HOM) at 300 g on an AggreWell 800 plate (34,850, StemCell Technologies) in E8-Flex medium supplemented with 50 ng/mL BMP4 (120-05ET, Peprotech), 50 ng/mL VEGF (PHC9394, ThermoFisher) and 20 ng/mL SCF (300-07, PeproTech). 75% medium change per day was performed for 72 h, after which EBs were transferred to a T75 flask and maintained in X-VIVO15 (BE02-060F, Lonza) supplemented with 25 ng/mL IL-3 (PHC0031, ThermoFisher), 100 ng/mL M-CSF (300–25, PeproTech), 2 mM Glutamax (35050061, ThermoFisher) and 0.055 mM β-mercaptoethanol (31350-010, ThermoFisher). Medium was topped up every week and after 4 weeks, emerging precursor cells were collected and differentiated to microglia-like cells for 7 days in microglia medium consisting of 25 mL DMEM/F12 (11330032, ThermoFisher) and 25 mL Neurobasal Plus media (A3582901, ThermoFisher) supplemented with 100 ng/mL M-CSF (300-25, Peprotech), 100 ng/mL IL-34 (200-34, peprotech) and 10 ng/mL GM-CSF (300-03, Peprotech), 2 mM Glutamax (35050061, ThermoFisher), 0.05 5 mM β-mercaptoethanol (31350, Life Technologies), and 0.25 μg/mL Insulin (I9278, Sigma).

iPSC-derived cortical neuron differentiation was adapted from Fernandopulle et al. [20], with slight modifications. In brief, BIONi010-C (BINI-10) iPSC cell lines (PLCG2^HET) were dissociated using accutase and seeded as single cells at a density of 5X10⁵ per well of a six-well plate. The cells were left to attach for 4 h. Cells were then transduced in a similar manner to the above protocol of PLCγ2 editing, but in this case using a CRISPR-cas9 RNP to stably integrate a doxycycline inducible NGN2 expression cassette (see supplementary methods—plasmids), into the CLYBL safe harbour site, allowing for the driving of cellular differentiation into cortical neurons. Double selection was performed using Blasticidin S (100 ng/mL) (203350-25MG, Sigma-Aldrich) and mApple markers to identify positive colonies. iPSCs stably expressing NGN2 were then induced in DMEM/F12 with HEPES (11330032, ThermoFisher) supplemented with; N2 (1X) (17502048, ThermoFisher), NEAA (1X) (11140050, ThermoFisher), Glutamax (1X) (35050038, ThermoFisher) and doxycycline (2 μg/mL) (D9891, Sigma). 72 h post-induction, the cells were transferred to PDL (A3890401, ThermoFisher) and Laminin (1:100 dilution in PBS) (23017015, ThermoFisher) coated plates and fed with Neurobasal Plus media (A3582901, ThermoFisher) supplemented with B27 (50X) (17504044, ThermoFisher), 10 μg/mL BDNF (450–02, PeproTech), 10 μg/mL NT-3 (450–03, PeproTech) and 1 μg/mL Laminin for up to 12 days.

BV2 cells (a gift from Prof. Frei, UZH) were cultured (140,000/well of a 12-well plate, 14,000 per EBD plate, 7,000/well of a 96-well plate) and maintained at 37 °C, 95% O₂ and 5% CO₂ in Dulbecco’s modified Eagle’s medium (31,885–023, Gibco) supplemented with 10% (v/v) foetal calf serum (A4768801, ThermoFisher) and 1% pen/strep (15,140,122, ThermoFisher).

The over-expression construct PLCγ2^P522R point mutation was inserted into the human PLCγ2^WT plasmid (RC200442, Origene) using Q5® site-directed mutagenesis kit (E0554S, NEB) according to manufacturer’s protocol. The mutagenesis primers used are listed in supplementary Table 1. For over-expression experiments, in brief BV2 cells were seeded onto either a 12-well plate or 8-well chamber slide (IB-80827, iBIDI) at a density of 140,000 and 21,000 cells per well, respectively, and allowed to settle for 24 h. 2 h prior to transfection a complete media change was done with fresh DMEM without pen/strep. For transfection, 50 ηg/100 μL of cDNAs (Control, PLCG2^WT and PLCG2^P522R plasmid) were mixed with 25 μL/100 μL Opti-MEM^® and 0.27 μL/100 μL of Lipofectamine™ 2000 (ThermoFisher) and incubated for 30 min. Afterwards, the media on the cells were replaced with transfection mix and incubated for 24 h. The media was then exchanged for fresh DMEM, and cells were incubated for a further 24 h before downstream assays, including uptake and metabolic profiling.

Protein was extracted from cultured BV2 cells or 7-day mature iPSC-derived microglia by lysis for 30 min at 4 °C in ice-cold RIPA buffer (150 mM NaCl, 10 mM Tris, pH 7.2, 0.1% SDS, 1% Triton X-100, 1% deoxycholate, 5 mM EDTA), supplemented with protease (78430, ThermoFisher) and phosphatase inhibitor (524625-1SET, MERCK) cocktails (ThermoFisher). The RIPA soluble fraction was obtained by centrifugation of the samples at 10,000×g for 10 min. Protein concentration was determined using the Pierce BCA Protein Assay Kit (Thermo Fisher Scientific). Samples were mixed with loading buffer (928-40004, Li-Cor) before boiling at 95 °C. SDS-PAGE separation (15–20 μg protein per sample) was performed on NuPAGE 4–12% gradient Bis–Tris gels (Thermo Fisher) and proteins were transferred to nitrocellulose membranes (IB23002, ThermoFisher) using an iBLOT2 following manufacturers protocol. Membranes were blocked for 1 h in 3% BSA in TBST (0.1% tween) before incubation with primary antibodies (supplementary Table 2) in 3% BSA in TBST overnight at 4 ⁰C. Membranes were washed 3 times 5 min and incubated with secondary antibodies (supplementary Table 2) for 1 h at room temperature before further washes using TBST. Membranes were analysed using a LI-COR Odyssey CLx system and protein levels were quantified using Image Studio Lite (LI-COR Biosciences), normalised to their corresponding β-Actin levels. Statistical significance was assessed using one-way ANOVA.

For the phagocytosis assay 5 × 10⁴ iMG progenitors were seeded onto 8-well chamber slide (IB-80827, iBIDI) coated with PDL and matured for 7 days with 50% medium change every other day. Uptake assays were then performed by exchanging 100% media to fresh media supplemented with either 250 ηM Aβ_1–42 HyLite Fluor 647 (AS-60493, AnaSpec), mouse brain purified ^tdTomato-tagged synaptosomes generated in house, FITC-Dextran 4kD (46944, Sigma), FITC-Dextran 150 kD (46946, Sigma), Zymosan beads-568 (Z23374↗, ThermoFisher) and 75 nM LysoTracker DND-99 (L7528, ThermoFisher) for 100 min. After elapsed time, iMG were washed with PBS and fixed with 4% paraformaldehyde for 30 min. Fixed iMG were subsequently stained with SNL (FL-1301-2, Vector) to visualise the membrane and with 2 µM Hoechst (62249, ThermoFisher) nuclear stain. Images were acquired using Nikon A1R inverted confocal microscope (Nikon) running the NIS elements software using 60 × oil immersion lens. Acquired images were analysed using FIJI and IMARIS, thresholding to WT/Control, marking ROI and quantified either as % Cell Area or uptake (cargo) volume per total cell volume. Statistical significance was assessed using a Kruskal–Wallis test.

To measure the residual level of Aβ in the co-culture assay, supernatant was collected from co-culture of 21-day mature iPSC-derived cortical neurons and 7-day mature microglia and centrifuged at 1000G to remove any cellular debris. In brief, immunochemiluminescence assay was performed by adding 150 μL of Diluent 35 (MSD) to each well of a 96-well multi-spot MSD plate (N45197A-1, MSD) and incubated at room temperature for 1 h, on a plate shaker. Subsequently, the plate was washed 3 times with Tris Wash Buffer (MSD). After washing, 25 μL of Aβ detection antibody (6E10, MSD) and 25 μL of prepared samples (cellular supernatant) was added to each well. The plate was incubated at room temperature for 3 h, on a plate shaker, prior to washing 4 times with Tris Wash Buffer. 150 μL of 2X Read Buffer (MSD) was added to each well. Samples were analysed on the MSD plate reader using default detection criteria. The MSD read outputs, indicative of Aβ level, were normalised to their corresponding total protein concentration and were analysed using GraphPad. Statistical significance was assessed using a Kruskal–Wallis test.

RNA was extracted from iPSC-derived microglia (iMG) and/or BV2 using Direct-zol RNA MiniPrep Kit (Zymo research) according to the manufacturer’s protocol. For RT-qPCR analysis, RNA was reverse transcribed into cDNA using iScript cDNA synthesis kit (BIO-RAD) according to the manufacturer’s protocol. Target specific PCR primers for mouse and human (Supplementary Table 3) were obtained from IDT. For qRT-PCR analysis Takyon Rox SYBR MasterMix dTTP blue (Eurogentec) was used. For relative expression analysis, the ΔΔCt comparative method was used to compare TBP-normalised expression level of the target mRNA. Data were normalised either to control (BV2) or WT groups (iMG) and are shown as median ± SD. Statistical significance for each gene was assessed using a Kruskal–Wallis test.

To measure oxygen consumption rates (OCR) and extracellular acidification rates (ECAR) in real time, iMG were seeded and matured for 7 days on a Seahorse 96-well cell-culture microplate (PerkinElmer) at a density of 25,000 cells per well. Mature iMG’s mitochondrial respiration was then analysed on the seahorse XFe96 Analyser (Agilent Technologies) using a Mitostress test kit (Agilent Technologies) according to manufactures protocol.

For BV2 cells, to measure OCR and ECAR, cells were seeded on a seahorse cell-culture plate at a density of 27,000 cells per well and transfected, as described, with cDNA (Control, WT and PLCG2-P522R) constructs. 24 h post-transfection, real-time mitochondrial respiration was measured using a Mitochondrial stress test kit (Agilent Technologies) on the seahorse XFe96 Analyser. All data were analysed using Wave v2.4.0.6 (Agilent technologies) and Graph pad. Statistica significance was assessed using a Kruskal–Wallis test.

To measure microglia motility, speed, and distance, iMG were plated on a glass bottom Ultra cell carrier 96-well plate (6055302, PerkinElmer), precoated with PDL, and matured for 7 days as previously described. Mature iMG were stained with nuclear mask blue (ThermoFisher) and cell mask orange (ThermoFisher) for 30 min. Cells were then washed with PBS twice and 100 μL of pre-warmed microglia media made in FluoroBrite (A1896701, Gibco) was added. iMGs were imaged for 2 h on a high-throughput imaging OperaPhenix (PerkinElmer) with both temp and CO₂ maintained at 37 °C and 5%, respectively. Image analysis was done using Harmony cell tracking software. Both tracked nuclear speed and cytoplasmic speed were exported and analysed using Graphpad.

To monitor Ca²⁺ levels in iMG, microglia progenitors were seeded on a glass bottom cell carrier Ultra 96-well plate and glass bottom 8-well chamber ibidi slides, precoated with PDL. iMG were matured for 7 days following the described protocol. To treat cells, mature iMG were washed with PBS once and 100 μL FloBright microglia media supplemented with cell permeable 2 μM Fura Red™, AM, cell permeant (F3021, ThermoFisher) was added to the 96-well plate and 300 μL was added to the iBidi plates and incubated for 30 min. Cells were then washed with PBS and FloBright microglia media devoid of Fura Red was added. Images were taken on a high-throughput microscope OperaPhenix (PerkinElmer) and Nikon spinning disc (Nikon), with analysis being performed using Harmony software and ImageJ. Background was subtracted from each frame and ratio-metric value of bound to unbound Ca²⁺ was extracted and analysed in GraphPad.

To investigate the protective role of PLCγ2^P522R in human microglia-like cells, we generated isogenic hiPSCs harbouring the P522R polymorph in hetero- and homozygosity using CRISPR-mediated gene editing, and differentiated them into microglia-like cells using a previously described protocol [21]. Upon differentiation, PLCγ2^WT, PLCγ2^HET and PLCγ2^HOM did not display any obvious phenotypic or karyotypic defects and robustly expressed microglia/macrophage-associated markers including TMEM119 and IBA1 (S. Figure 1). Western blot analysis of PLCγ2 protein levels in the cells detected no significant differences between the three lines (Fig. 1A, B).

To understand the role of PLCγ2^P522R in two key aspects of neuroAD pathology, we examined whether it affects microglial-mediated Aβ clearance and synaptic pruning. To this end, we incubated PLCγ2^WT, PLCγ2^HET and PLCγ2^HOM iPSC-derived microglia with fluorescently tagged Aβ_1-42 or ^tDtomato tagged synaptosomes purified from mouse brain. Microglia expressing the PLCγ2^P522R variant demonstrated a robust increase in Aβ uptake compared to the control (Fig. 1C, D), irrespective of heterozygosity. We also saw an increase in lysotracker levels, indicating increased acidic endolysosomal vesicles, in PLCγ2 variants compared to the PLCγ2^WT, with PLCγ2^HET having slightly higher levels than PLCγ2^HOM (Fig. 1C, E). By contrast, synaptosome uptake was significantly reduced in PLCγ2^P522R variants with a dose-dependent reduction between PLCγ2^HET and PLCγ2^HOM variant cells (Fig. 1F, G). To further establish whether these findings were associated with the PLCγ2^P522R variant, and not a consequence of off-target effects, we transfected BV2 cells, with either a Control, PLCγ2^WT or PLCγ2^P522R construct, followed by incubation with Aβ_1-42 peptides and synaptosomes. PLCγ2 expression per se resulted in a robust increase in Aβ uptake compared to the control (S. Figure 2) and a non-significant mild enhancement (p = 0.3385) was seen in PLCγ2^P522R expressing cells. Furthermore, Aβ accumulation was predominately observed in subcellular compartments, such as lysosomes, while synaptosomes were internalised by the control, but appeared predominantly bound to the cellular membrane in P225R mutants (S. Figure 2). In these cells, PLCγ2 is effectively over-expressed; hence, these data primarily demonstrates an impact of increased PLCγ2 expression per se on Aβ and synaptosome uptake. Since the P522R variant appears to be a mild hypermorph [16], it is likely that mild changes induced by the presence of this variant are masked by the larger impact of PLCγ2 over-expression. However, the differential localisation of synaptosomes between PLCγ2^WT and PLCγ2^P522R over-expression suggests that the impact of the variant on synaptosome uptake may be linked not only to altered protein levels, but also to a possible functional change.

In addition, BV2 cells generally display a small round body with no obvious extensions, similar to the amoeboid-like state reported in vivo [22]; however, when transfected with PLCγ2 construct these cells displayed a bigger, elongated phenotype with several cytoplasmic extensions, possibly indicating a more ramified state (S. Figure 3). Microglial ramifications are typically indicative of resting state microglia, which play an active role in the surveillance and monitoring of the brain parenchyma, with studies showing that insults such as injury result in reduced ramification [23]. It is therefore possible that PLCγ2 may play a role in the regulation of microglial surveillance. A previous study has suggested that the P522R variant may promote microglial activation [17], hence indicating a role for this protein in microglial activation state.

It has been suggested that Aβ may facilitate synaptic pruning by microglia by acting as a tag for targeting synapses [24]. To investigate whether the hiPSC microglia variants would specifically target Aβ peptides for clearance or indiscriminately target Aβ and synaptosomes, we incubated mature hiPSC-derived microglia with Aβ and synaptosomes concurrently. 3D Image analysis showed increased Aβ uptake by PLCγ2 microglia variants compared to controls, with no clear significant difference between the PLCγ2^HET and PLCγ2^HOM lines (Fig. 2A, B). Synaptosome uptake on the other hand was lower in the PLCγ2^HET microglia compared to both PLCγ2^WT and PLCγ2^HOM cells (Fig. 2A, C), suggesting that the ‘dose level’ of the P522R variant plays a key role in its altered function.

The monoculture assays strongly suggest that the PLCγ2^P522R protective variant modulates the uptake of Aβ and synaptosomes in an opposing manner. However, this work was conducted in monocultures, which lack the complex neuronal architecture and multicellular networks seen in vivo. Hence, we replicated our initial experiments in a neuronal-microglial cell co-culture system. PLCγ2^WT, PLCγ2^HET or PLCγ2^HOM microglia progenitor cells were added to 2-week-old iPSC NGN2-derived cortical neurons, bearing the PLCγ2^HET polymorph, and kept for a further 7 days in co-culture allowing the microglia to reach maturation. As expected, microglia were actively involved in synaptic pruning, as measured by PSD95 engulfment, in all conditions tested (Fig. 2D–F). However, the PLCγ2^HET variant demonstrated significantly reduced uptake of PSD95 compared to the PLCγ2^WT variant (Fig. 2D, E). Interestingly, no significant difference was observed with the PLCγ2^HOM microglia. These data highlight our finding that the maximal beneficial impact on synapse pruning is seen in cells heterozygous for the variant. The disparity between our mono- and co-culture findings further suggests that additional mechanisms involved in synaptic pruning beyond phagocytic uptake per se may be subtly impacted by the presence of PLCγ2^P522R. We also collected supernatant from the co-culture assay to probe for Aβ_1–40 levels (released endogenously by the iPSC-derived neurons) using an MSD plate reader. While all conditions containing microglia recorded reduced Aβ level compared to neuronal cells in the absence of microglia, only cultures containing microglia heterozygous for the PLCγ2^P522R variant reached significance (p = 0.036), indicative of increased Aβ uptake by these cells (Fig. 2F). These results collectively establish that heterozygous PLCγ2^P522R expression enhances the clearance and modulation of Aβ peptides while sparing synapses in a co-culture setup, providing a possible mechanism for AD protection.

PLCγ2^P522R has previously been reported to influence selective cargo uptake, suggesting a shift towards endocytic pathways [15]. Given the differential impact of heterozygous and homozygous PLCγ2^P522R on Aβ and synaptosome uptake, we sought to further investigate whether similar cargo selectivity differences were observed in our microglial cell model. We assessed hiPSC-derived microglial uptake of Zymosan beads of approximately 3 μm diameter and two dextran glucans of 150 kD and 4 kD. Consistent with our findings for Aβ, PLCγ2^HET microglia had a significantly higher uptake of Dextran^4kD and Dextran^150kD compared to the PLCγ2^WT and PLCγ2^HOM variants (Fig. 3A–D). Likewise, both PLCγ2^HET and PLCγ2^HOM cells showed a reduced uptake of zymosan particles compared to PLCγ2^WT microglia (Fig. 3E, F), consistent with the previously reported shift towards the endocytic uptake of smaller cargoes.

Similar studies in BV2 cells over expressing either WT or P522R PLCγ2 showed that over-expression of the protein, irrespective of the variant, resulted in a marked increase in zymosan uptake, and reduced uptake of both the dextran substrates, supporting the notion that PLCγ2 plays a key role in the regulation of microglial uptake size-selectivity. For both zymosan and 4 kDa Dextran, the P522R variant displayed a trend towards reduced effects compared to WT over-expression, in contrast, the P522R variant significantly enhanced uptake of Dextran^150kD (S. Figure 4).

To begin to unpick the cellular pathways that may play a role in PLCγ2^P522R altered uptake of AD relevant cargoes, we investigated the effect of the variant on the expression profiles of a number of functionally relevant microglial genes. We focussed on pathways previously identified as potentially playing a role in AD progression, as well as core genes involved in modulating microglial immune function and functional status.

We harvested 7-day differentiated hiPSC-derived microglia in the absence of additional stimulus (‘resting’) and probed the expression profile of a selection of different genes (Fig. 4). We saw significant increases in the expression of a small number of genes associated with lipid metabolism (LIPA; p = 0.0374, APOE; p = 0.0331, PLIN2; p = 0.0422), endosome/phagosome maturation (RAB5; p = 0.0351, RAB7; p = 0.0174) and cytokines/chemokines (IL-10; p = 0.0043, CX3CR1; p = 0.0475) in PLCγ2^HET cells compared to PLCγ2^WT cells. Only one of these genes, APOE, was found to be significantly increased in PLCγ2^HOM cells (p = 0.0374). A small number of additional genes also showed a trend towards increased expression in PLCγ2^HET cells, although these did not reach significance (CD68; p = 0.1656, P2RY12; p = 0.1739, NLRP3; p = 0.1498, CYP1A1; p = 0.1209, CYP1B1; p = 0.1219, TMEM119; p = 0.1739). Although we did not see any significant differences between PLCγ2^HET and PLCγ2^HOM cells, there was a trend towards significant differences in RAB5 (p = 0.1737), CX3CR1 (p = 0.1221) and Il-10 (p = 0.0753), highlighting the potential importance of these genes in the functional impact of the PLCγ2^P522r variant. These findings suggest that PLCγ2^HET cells display a subtly different expression profile to both control and PLCγ2^HOM cells even in a resting state, that may underpin the protective effects of the P522R variant seen in our functional assays and in AD.

The bioenergetic profile of microglia is directly linked to their functional state. Given that the PLCγ2^P522R variant impacts on metabolic and mitochondrial biogenesis pathways and shows increased Aβ uptake, an energy-demanding process, we speculated that it may impact directly on mitochondrial function. To investigate the role of PLCγ2 on mitochondrial respiration we employed an Agilent Seahorse assay to look at the mitochondrial oxygen consumption rate (OCR), a measure of mitochondrial function. Under a mitochondrial stress test paradigm, PLCγ2^HET and PLCγ2^HOM cells showed a dose-dependent increase in basal and maximal respiration compared to PLCγ2^WT cells (Fig. 5A–C). ATP production was also increased (Fig. 5D). Proton leak (the migration of protons across the mitochondrial membrane independent of ATP-synthase) was dose dependently higher in the PLCγ2^P522R cells compared to the PLCγ2^WT variant (Fig. 5E). It has been suggested that increased proton leak is directly related to the prevention of oxidative stress, the inhibition of fatty acid induced mitochondrial damage and the control of oxidative phosphorylation [25], potentially protecting the cell from excessive damage. Hence, our findings suggest superior mitochondrial performance in PLCγ2^P522R variants.

To check whether increased mitochondrial function was simply a result of increased mitochondrial number, we incubated matured microglia with mitotracker. Confocal imaging revealed a comparable level of mitotracker in all PLCγ2 variant cells, thus mitochondrial number is unlikely to be affected by the presence of the P522R variant (Fig. 5F, G). We also probed for TOMM20 (Translocase Of Outer Mitochondrial Membrane 20); part of the mitochondrial receptor complex responsible for the recognition and translocation of cytosolically synthesised mitochondrial preproteins. Western blot analysis revealed no difference in TOMM20 protein expression between PLCγ2^P522R and PLCγ2^WT cells (Fig. 5H, I). These data suggest that altered mitochondrial function was solely responsible for enhanced OCR and ATP production as opposed to changes in mitochondrial number.

To validate our hiPSC-derived microglia findings, we again transfected BV2 cells with the WT or P522R variant PLCγ2, or control constructs and monitored OCR in real time using the seahorse extracellular flux analyser. Consistent with our hiPSC-derived cells, BV2 cells overexpressing PLCγ2^P522R and PLCγ2^WT had significantly higher levels of basal respiration, maximal respiration and ATP production compared to those transfected with the control construct (SFig 5). Interestingly, while maximal respiration in cells over expressing PLCγ2^P522R was significantly lower than cells over expressing the WT protein, the ATP production was comparable, indicating an optimal level of mitochondrial function in PLCγ2^P522R cells that efficiently met the ATP demand (S. Figure 5C, D). Likewise, BV2 cells with PLCγ2 over-expression showed a higher level of proton leak compared to controls, with no clear difference between PLCγ2^WT and PLCγ2^P522R (S. Figure 5E). In conclusion, we identified a novel role of PLCγ2 on mitochondrial function, which indicates better microglial metabolic fitness.

PLCγ2 activity can induce calcium influx from the ER through the binding of IP3 to its receptor in the ER, IP3R [26]. This massive cytoplasmic Ca²⁺ influx is critical for various downstream signalling pathways that modulate numerous microglial functions. Hence, to investigate whether there are any differences in Ca²⁺ levels between the different PLCγ2 variants, we incubated the hiPSC-derived microglia with the cell permeable, light-excitable calcium sensor molecule Fura Red™. Live-cell imaging revealed significantly higher Ca²⁺ intensities, indicating higher Ca²⁺ levels, in PLCγ2^HET microglia compared to PLCγ2^WT cells, that was not seen in PLCγ2^HOM cells (Fig. 6A, B). Indeed, PLCγ2^HOM microglia had slightly reduced Ca²⁺ levels compared to PLCγ2^WT cells, although this did not reach significance (p = 0.1528). We also assessed changes in resting Ca²⁺ levels over time. Microglia were treated with Fura Red™ for 30 min and Ca²⁺ intensity monitored for 120 min. Consistent with our previous findings, both PLCγ2^HET and PLCγ2^WT microglia variants had persistently higher basal Ca²⁺ intensity compared to microglia with the PLCγ2^HOM variant (S. Figure 6).

The role of Ca²⁺ in cell migration and adhesion is well documented, hence given the differences in Ca²⁺ intensity among our PLCγ2 variants, we decided to investigate if this may impact on microglial motility. We assessed two parameters: nuclear tracking, for whole cell migration, and cytoplasmic tracking, for microglial ramification and surveillance. Microglia were tracked for 2 h and their motility assessed in untreated (homeostatic) conditions. Consistent with the changes observed in Ca²⁺ levels, PLCγ2^HET microglia had significantly higher nuclear speeds compared to PLCγ2^WT (p = 0.01) and PLCγ2^HOM (p = 0.007) variants, which themselves did not significantly differ (p = 0.99) (Fig. 6C). Cytoplasmic motility was also significantly enhanced in PLCγ2^HET cells, potentially indicative of increased surveillance activity (Fig. 6D).

In addition, by measuring total distance covered by the cells, we investigated whether the tracked speed had any connection to distance travelled. Consistent with our tracked speed findings, PLCγ2^HET significantly outperformed both PLCγ2^WT and PLCγ2^HOM variants in total distance covered (Fig. 6E). Our findings indicate that PLCγ2^HET microglia were more active in both surveillance and migration compared to PLCγ2^WT and PLCγ2^HOM microglia, and this could be tied to their housekeeping Ca²⁺ level.

The authors declare that they have no competing interests.

Not applicable.

All data generated or analysed during this study are included in this published article [and its supplementary information files].