What this is
- This research investigates the effects of IL-4 on microglial activity and amyloid-β (Aβ) deposition in Alzheimer's disease models.
- Microglia, the immune cells of the central nervous system, can adopt different activation states, notably M1 and M2.
- The study aims to promote an using IL-4 and assess its impact on microglial activation and Aβ pathology.
Essence
- IL-4 induces a robust in microglial cells, which is associated with increased and astrogliosis. A trend toward reduced Aβ levels was observed in APP/PS1 transgenic mice following IL-4 treatment.
Key takeaways
- IL-4 application leads to a significant increase in M2a phenotypic markers in BV2 microglial cells, peaking at 8 hours post-treatment. This indicates a strong polarization towards a neuroprotective state.
- In APP/PS1 transgenic mice, IL-4 treatment resulted in increased and astrogliosis, as evidenced by elevated CD11b and GFAP immunostaining. This suggests an enhanced immune response in the brain.
- A decreasing trend in Aβ levels was noted in IL-4-treated mice compared to controls, although this did not reach statistical significance. The results indicate potential therapeutic implications for modulating microglial responses in Alzheimer's disease.
Caveats
- The study faced limitations due to premature termination, which restricted the measurement of Aβ deposition. This may affect the validity of the observed trends.
- Conflicting results regarding IL-4's effects on Aβ pathology in previous studies highlight the complexity of neuroinflammatory responses and necessitate further investigation.
Definitions
- M2a phenotype: A microglial activation state characterized by neuroprotection and repair, often promoted by IL-4.
- microgliosis: The proliferation and activation of microglia in response to injury or disease, often associated with inflammation.
Simplified
Introduction
Alzheimer’s disease (AD) was first identified in 1907 by Alois Alzheimer when investigating the case of a female patient, Auguste D, suffering from irrational personality changes and severe memory impairment. Post mortem analysis revealed a severely atrophied brain, and histological staining revealed amyloid-β (Aβ) plaques and neurofibrillary tangles composed of hyperphosphorylated and aggregated tau. In addition, Alzheimer noted a proliferated cluster of immune regulatory and support cells surrounding the Aβ plaques and termed this “gliose”, now known as the inflammatory response “gliosis” [1]. This observation signified a potential interaction between immune regulation and the development Aβ lesions, a critical relationship that had previously been understudied until the last 2 decades [2]. Inflammation, the final pathology of the triad, marks the body’s protective response to detrimental stimuli and injury. To date, an abundance of studies has confirmed the role of inflammation in the pathological progression of AD [3].
Derived from a mesodermal myeloid origin, microglia act in parallel to their sister immune regulatory cells of the periphery, macrophages, in the central nervous system (CNS) [4]. Current understanding of microglial physiology and activity, including phenotypic diversity, has been extrapolated. In response to immune stimulation, a spectrum of macrophage phenotypes is unveiled [5,6]. M1 activation, or classical activation, is considered the first line of defence to eradicate invading pathogens and is both driven and characterized by the release of proinflammatory cytokines such as interleukin 1β (IL1β) and tumor necrosis factor α (TNFα). On the other side of the spectrum, M2 activation, or alternative activation, is associated with wound repair and healing, as well as the ability to dampen the M1 response [7-10]. M2 activation is broken into additional sub-categories. M2a activation is characterized by the expression of mannose receptor MRC1 and extracellular matrix modeling ability with the expression of chitinase 3-like 3 proteins (YM1 in mice CHL3 in humans) and arginase 1, ARG1. Sequentially, acquired “deactivation” of the immune response is achieved by an M2c phenotype upon interleukin 10 (IL-10) exposure with amplified expression of transforming growth factor β1 (TGFβ1) and sphingosine kinase 1 (SPHK1). The role of an M2b phenotype is relatively unknown. Nonetheless, it has been defined by an elevated expression of the CD86 and major histocompatibility complex II (MHCII) receptors in comparison to the low constitutive expression of these receptors across all activation phenotypes [7,10].
An intricate cytokine network tightly controls the amplification and reduction of each of the microglial states. IL-4 is considered to be the strongest polarizing cytokine toward an M2a response [11]. IL-13 has also been noted as an M2a polarizing cytokine. The interaction of an M2a phenotype with Aβ remains unclear. The induction of an M2a phenotype via IL-4 exposure has indicated both attenuation and amelioration of the neurotoxic peptide depositions in conflicting in vivo studies [12,13].
To assess M2a-driven modulation of microglial activation, IL-4 was endogenously applied to BV2 microglial cells and temporal changes in phenotype and morphology were monitored. Results revealed a robust M2a phenotype peaking at 8 h for the majority of phenotypic markers. Amplification of alternative phenotypic genes also revealed a peak in expression suggesting a minutely heterogeneous phenotype. Morphology showed reduced extended process upon IL-4 application, with the effects dampened over time and extended process formation. In order to better understand the effect of an M2a phenotype on Aβ deposition, bilateral injections of an adeno-associated virus (AAV) expressing IL-4 were inserted into the frontal cortex and hippocampus of APP/PS1sw mice. A robust M2a phenotype was successfully induced with the AAV IL-4 injection. Histological staining revealing increased microgliosis and astrogliosis in the AAV-IL-4 injected mice. Lastly, Aβ levels measured biochemically were moderately reduced in comparison to the mice treated with AAV-GFP, therefore providing insight into a potential mechanism of ameliorating Aβ pathology in AD.
Material and methods
BV2 cell culture
BV2 cells were obtained from Dr. Linda Van Eldik, University of Kentucky, Lexington, KY. Cells were grown on six-well plates in FX12 media containing 10% fetal bovine serum, 1% serum L-glutamate and 1% streptomycin (Life Technologies, Carlsbad, CA) until 80% confluency was obtained approximately 3 days after passage. Cells were starved of serum for 24 h prior to treatment. Cells were stimulated with an exogenous application of murine IL-4 (20 ng/ml; R & D Systems, Minneapolis, MN) in the serum-free medium added to the culture. Serum-free medium was applied as the no treatment control. Cells were incubated (5% CO2, 37°C) for 2, 4, 6, 8, 10, 16 and 24 h before removal. Media were aspirated, and cells were rinsed twice in Dulbecco’s phosphate-buffered saline pH 7.4 (DPBS) (Life Technologies, Carlsbad, CA) at a 1× dilution for 5 min and frozen at −80°C. Cell culture experiments were performed in triplicate and repeated at least three times at different passage numbers.
Immunofluorescent staining
BV2 cells were grown on glass coverslips in 12-well plates until 80% confluency after approximately 3 days from passage. Twenty-four hours prior to the experiment, cells were starved and treated as above. After incubation cells were rinsed in 1× DPBS, transferred to a clean 12-well plate, fixed in 10% neutral buffered formalin (Sigma-Aldrich, St Louis, MO) for 20 min and rinsed twice in 1× DPBS for 5 min. Cells were blocked in 0.019% L-lysine, 0.3% triton-X (Sigma-Aldrich, St Louis, MO) and 4% goat serum (Pel-Freez, Rogers, AR) in DPBS for 45 min and incubated in primary antibody CD11b 1:500 (Rat monoclonal, AbD Serotec, Raleigh, NC) in 1× DPBS overnight at 4°C. Cells were left to acclimate to room temperature for 1 h and rinsed twice in 1× DPBS for 5 min before incubation in secondary goat anti-rat (488 nm) at a 1:20,000 dilution of for 1 h. Glass coverslips were rinsed twice in 1× DPBS prior to adhesion to microscope slides using Permafluor mountant (Thermo Scientific, Fremont, CA). Fluorescence was visualized using Nikon Elements BR image analysis system (Melville, NY) at 60× magnification. The same settings were applied to all of the images.
Animals
This study was approved by the University of Kentucky Institutional Animal Care and Use Committee and conformed to the National Institutes of Health Guide for the Care and Use of Animals in Research. Fourteen APP/PS1 transgenic mice [14], a C57BL6 strain of mice with human APPSwe and PS1-dE9 mutations, were bred in the Division of Laboratory Animal Resources (DLAR) at the University of Kentucky and aged for 3 months prior to surgery. The animals were randomly assigned into one of two groups for adeno-associated virus type 8 (AAV-8) injection, either the AAV-GFP control group (N = 8) or the AAV-IL-4 group (N = 6). Data revealed no gender-dependent differences and were therefore analyzed together. Mice were killed 43 days post-surgery because of increased deaths in the IL-4-AAV-injected animals.
AAV preparation
The vector for preparing recombinant AAV was constructed by ligating the 1,349-bp EcoRI/SalI fragment carrying the IRES-GFP from pSMPUW-IRES-GFP (Cell Biolabs) into EcoRI/SalI-digested pZac2.1 (gift of Dr. Paul Murphy, University of Kentucky) to create ViCo1.28. The IL-4 insert was prepared by polymerase chain reaction (PCR) amplification of cDNA clones obtained from Open Biosystems (GE Healthcare, Dharmacon RNAi and gene expression, Piscataway, NJ). The IL-4 PCR primer sequence used was ‘CCCGCTAGCGACGGCACAGAGCTATTG.
CCACCGCGGGGCTCAGTACTACGAGTA’ (Open Biosystems, GE Healthcare, Lafayette, CO; Cat. no.: MMM1013-7510313, clone ID 3376587 and accession BC027514↗). The primers introduced a NheI site at the 5′-end and a SacII site at the 3′-end of each cytokine gene to facilitate cloning into the corresponding sites in ViCo1.28. The fidelity of each clone was confirmed by DNA sequence analysis.
AAV-8 coat protein-pseudotyped AAV-2 viruses were prepared by co-transfecting 10 T225 culture flasks of 293LTV cells (Cell Biolabs) with 250 mg pAAV2/8 (obtained from the University of Pennsylvania Viral Core), 500 mg pAdDF6 (gift of Dr. Paul Murphy, University of Kentucky) and, individually, 250 mg of each cytokine clone using 5 mg polyethyleneimine to enhance DNA uptake. After 3 days, the cells were harvested, washed, suspended in 13 ml 150 mM NaCl, 50 mM Tris · Cl pH 8.4, 0.5% deoxycholate and 50 U/ml of benzonase and incubated at 37°C for 30 min. An additional 2.8 ml 5 M NaCl was added, and the incubation was continued for another 30 min at 45°C. The cell suspension was then subjected to four freeze/thaw cycles (30 min at −80°C/ 30 min at 45°C). The lysate was then partially clarified by centrifugation at 18,500 × g for 10 min at 20°C. The supernatant was laid on top of an iodixanol step gradient and centrifuged at 350,000 × g for 1 h at 18°C. The interface between the 40% and 54% iodixanol layers was withdrawn and spin-purified and concentrated using four washes with PBS in an Amicon Ultra-15 100,000 MWCO spin concentrator. The virus preparation was then titered using real-time PCR with primers directed against the CMV promoter region of the DNA encapsulated in the virions.
Bilateral intracranial injections

andCD11b staining of hippocampal sections of the AAV-GFP- and the AAV-IL-4-injected mice, respectively.andStaining in the dentate gyrus (); anshows the site of the hippocampal injection.The percentage of binary area occupied by the positive immunostain in the hippocampus across all samples;uses (= 4) for AAV-IL4 samples because of damage in the frontal cortex of two AAV-IL-4 mice. *< 0.05 between the AAV-GFP control (= 8) and AAV-IL-4 (= 6). IL-4 shows increased CD11b immunostaining. A B C D E F DG arrow N P N N
Tissue processing
After 43 days post-surgery, the mice were administered a lethal intraperitoneal injection of 0.5 ml of Buthanasia-D (Butler-Schein, Dublin OH) and intracardially perfused with 25 ml 0.9% saline (Ricca Chemical Co., Arlington, TX). The brain was removed immediately and bisected along the mid-sagittal plane. The left hemisphere was post-fixed in 4% paraformaldehyde for 24 h before being treated for cyroprotection through a series of 10, 20 and 30% sucrose concentrations each for an additional 24 h. The left hemisphere was placed on a frozen stage and sectioned into 25-μm horizontal sections, which were collected using a sliding microtome. The sections were stored free-floating in 1× DPBS plus sodium azide at 4°C. Sections were stored in 24-well plates at 4°C until required. The frontal cortex and hippocampus of the right hemisphere were micro-dissected, snap-frozen in liquid nitrogen and stowed at −80°C.
Immunohistochemistry
A Nissl stain was used to determine the injection site location determined as previously described [15]. Eight free-floating 25-μm sections spaced ~400 μm from each other were collected 1,300-3,400 μm ventral to bregma and separated into 1× DPBS. Initially, the free floating sections were permeabilized, and endogenous peroxidase sites were inhibited via incubation with 10% methanol and 3% hydrogen peroxide in 1× DPBS for 15 min. Sections were blocked with 0.3% triton-X, 4% goat serum and 0.019% L-lysine in 1× DPBS. Sections were incubated in primary antibodies CD11b, 1:3,000 (Rat monoclonal, AbD Serotec, Raleigh, NC) and GFAP, 1:10,000, (Rabbit polyclonal, Dako, Denmark) with 4% goat serum in DPBS left at room temperature and then overnight at 4°C. After incubation and three 5-min washes in 1× DPBS, sections were incubated in biotinylated secondary antibodies; goat anti-rabbit IgG was used for GFAP and goat anti-rat for CD11b, both at 1:3,000 (Vector Laboratories, Burlingame, CA) for 2 h. Amplification of the secondary antibody signal was achieved through incubation in advidin-biotin complex (ABC) (Vector Laboratories, Burlingame, CA) for 1 h. For color development the vector diaminobenzidine (DAB) peroxidase kit (Vector Laboratories, Burlingame, CA) was used according to the manufacturer’s instructions. Sections were mounted onto slides, left to air-dry overnight, dehydrated in an ethanol gradient followed by xylene incubations and cover-slipped using DPX mountant (Electron Microscopy Sciences, Hatfield, PA).
Images of the stained sections were taken at 200× magnification using the Nikon Elements BR image analysis system (Melville, NY) in the frontal cortex (FCX). Hippocampal fields were localized to the dentate gyrus (DG), cornu ammonis 1 (CA1) and cornu ammonis 3 (CA3) and images collected at the same magnification. Anatomical structures in the tissue were used to ensure uniformity in the image. Microscope settings were saved and were the same for all of the images in each stain. A threshold for positive immunostaining was set, saved and applied to all of the images of a given stain. The data yielded the percentage of binary area occupied by the positive immunostain. Approximately six sections per mouse were used for analysis in the hippocampus and the frontal cortex. Tissue damage in the frontal cortex of several animals left large holes interfering with quantification of the positive immunostain analysis. Therefore, two mice in the AAV-IL-4 group were exempt from this analysis.
ELISA measurements
Protein was extracted from the frontal cortex tissue by homogenization in mammalian protein extraction reagent (MPER) lysis buffer with protease and phosphatase inhibitor (Pierce Biotechnology Inc., Rockford, IL). The samples were centrifuged for 15 min at 10,000 rg at 4°C. The supernatant was collected as the soluble extract, leaving a pellet of remaining insoluble extract. A Bicinchonic Acid protein assay kit (BCA) (Pierce Biotechnology Inc., Rockford, IL) was performed to obtain the concentration of the soluble extract according to the manufacturer’s instructions. The soluble extracts were normalized to the lowest concentration using the MPER lysis buffer. Then 250 μl of 70% formic acid was added to the insoluble extract before ultracentrifugation at 47,000 rpm at 4°C for 1 h. The supernatant was collected and neutralized 1:20 with Tris–HCl (pH 11). Additional HCl was added to bring the sample accurately to pH 7 using a drop pipet. A Meso Scale Discovery (MSD) 96-Well MULTI-SPOT Human (6E10) A-beta Triplex Assay (MSD, Gaithersburg, MD) was performed on both the soluble and insoluble extractions, according to the manufacturer’s instructions, to determine the concentrations of Aβ38, Aβ40 and Aβ42. Murine IL-4 levels in the soluble extracts were detected using the the Mouse IL-4 Quantikine ELISA kit (R & D Systems Inc., Minneapolis, MN). All steps followed the manufacturer’s instructions. A second BCA was performed on soluble extracts to confirm the protein concentration, and samples were normalized prior to the ELISA measurement.
Quantitative real-time RT-PCR
RNA was extracted from the frozen hippocampus of the right hemisphere by rotor homogenization Bio-Gen Pro200 (Pro-Scientific, Oxford, CT) in the RNA-Solv Reagent of the RNeasy tissue kit (Qiagen, Valencia, CA); the subsequent steps of the extraction were achieved according to the manufacturer’s instructions. BV2 cell homogenization RNA was extracted from the BV2 cells using cell scrapers in RLT buffer of the RNeasy Mini-kit (Qiagen, Valencia, CA). Again, the subsequent steps of the extraction were achieved according to the manufacturer’s instructions. The Biospec-Nano Spectrophotometer (Shimadzu, Kyoto, Japan) was used to quantify the nucleic acid concentration in the RNA samples. The RNA concentrations were standardized to the lowest concentration with RNAase free water. The standardized samples were added to the High Capacity RNA-to-cDNA kit (Applied Biosystems, Foster City, CA) including reverse transcriptase, random primers and buffer according to the manufacturer’s instructions. The cDNA was produced through a series of heating and annealing cycles in the Veriti™ 96-well Thermocycler (Applied Biosystems, Grand Island, NY).
| Gene of interest | PMID | Taqman ID |
|---|---|---|
| IL-1β | NM_008361.3 | Mm00434228_m1 |
| IL-12 | NM_008351.2 | Mm00434165_m1 |
| TNFα | NM_013693.3 | Mm00443258_m1 |
| IL-6 | NM_031168.1 | Mm00446190_m1 |
| IFNγ | NM_008337.3 | Mm01168134_m1 |
| IL1ra | NM_031167.5 | Mm00446186_m1 |
| ARG1 | NM_007482.3 | Mm00475988_m1 |
| YM1 (Chil3) | NM_009892.2 | Mm00657889_mH |
| FIZZ1 | NM_020509.3 | Mm00445109_m1 |
| MRC1 | NM_008625.2 | Mm00485148_m1 |
| CD86 | NM_019388.3 | Mm00444543_m1 |
| FcγR1 | NM_010186.5 | Mm00438874_m1 |
| FcγR3 | NM_010188.5 | Mm00438882_m1 |
| TGFβ1 | NM_011577.1 | Mm01178820_m1 |
| SPHK1 | NM_011451.3 | Mm01252544_m1 |
Data analysis
For the in vitro analysis, normalized fold change values were log-transformed in order to apply parametric statistical methods. Repeated measures ANOVA, with an unstructured covariance matrix, was then used to estimate mean log fold change at each time point within each gene. The time point at which expression peaked was determined by post hoc testing such that the largest point estimate observed was then compared to the remaining time points. No ties were observed for peak time (i.e., the largest point estimate was identifiable for each gene). Repeated measures analyses were performed using the MIXED procedure in SAS 9.3® (SAS Institute, Inc., Cary, NC). Otherwise, group differences were assessed using two-sample Student’s t-tests. Analysis tests and data representation were performed using GraphPad Prism version 6.01 for Windows (GraphPad Software, La Jolla, CA, USA). Statistical significance was set at 0.05.
Results
To determine the morphology and activation of microglia in response to the AAV-IL-4 treatment, tissue sections were stained with a β-integrin marker, CD11b. In the hippocampus, Figure 1A and B shows an increased trend in positive CD11b immunostaining. In particular, the DG reveals a positive increase in the positive immunostaining (Figure 1C and D). An arrow in Figure 1C highlights microglial activation around the injection site of the AAV-IL-4 mice. Interestingly, we found increased CD11b staining in the hippocampus of AAV-IL-4 mice, which was statistically significant in the dentate gyrus region (Figure 1E), but we did not see changes in the frontal cortex (Figure 1F).

Data are shown as the average fold change (± SEM) relative to the no treatment control at the 2-, 4-, 6-, 8-, 10-, 16- and 24-h time points. *The peak time point of gene expression determined by a repeated measures ANOVA of the fold changes in logarithmic form. The relative gene expression for genes representative of the (A) M1, (B) M2a, (C) M2b and (D) M2c phenotypes of the IL-4-treated cell culture.

Immunofluorescent staining of no-treatment control cells at 2, 4, 6 8, 10, 16 and 24 h, respectively.Staining of cells exposed to the IL-4 treatment at 2, 4, 6, 8 10, 16 and 24 h, respectively. Images were taken with approximately the same cell confluency at a magnification of 60× and show a higher density of processes in the no treatment control compared to the IL-4-treated cells until 16 h.indicates extended processes seen on the untreated BV2 cells at 6 h. BV2 cell culture exposed to CD11b immunofluorescent staining over time. A-G H-N Arrow

The figure shows the relative gene expression for genes representative of the M1, M2a, M2b and M2c phenotypes relative to the 18-s endogenous control. Data are shown as the average fold change (± SEM) normalized to the AAV-GFP control. *< 0.05 between the AAV-GFP control (= 8) and AAV-IL-4 mice (= 6). **< 0.01 between the AAV-GFP control and AAV-IL-4 mice. IL-4 induces an M2a neuroinflammatory phenotype in APP/PS1 transgenic mice. P N N P

andGFAP staining of hippocampal sections of the AAV-GFP- and the AAV-IL-4-injected mice, respectively.The percentage of binary area occupied by the positive immunostain in the hippocampus across all samples;uses (= 4) for AAV-IL4 samples because of damage in the frontal cortex of two AAV-IL-4 mice. *< 0.05 between the AAV-GFP control (= 8) and AAV-IL-4 (= 6). IL-4 shows increased GFAP immunostaining. A B C D N P N N

This figure shows the relative amyloid-β expression (1–38,1-40,1-42) detected using a Meso Scale Discovery assay (MSD) for the AAV-GFP control and the AAV-IL-4-treated APP/PS1 transgenic mice. No statistically significant difference was seen between the AAV-GFP control and AAV-IL-4 groups, but the results show a decreasing trend (= 8 AAV-GFP and= 6 for AAV-IL-4). Immunostained Aβ plaques with Congo red could not be detected because the mice were only 3 months old. Compact plaques can be seen at 6 months of age. IL-4 causes a small decrease in Aβ deposition. N N
| IL1β | 2 | 4 | 6 | 8 | 10 | 16 | 24 | |
|---|---|---|---|---|---|---|---|---|
| 2 | 0.9613 | 0.3623 | 0.0024 | 0.3746 | 0.0354 | 0.0218 | ||
| 4 | 0.4365 | 0.027 | 0.2481 | 0.0405 | 0.168 | |||
| 6 | 0.0122 | 0.2677 | 0.0698 | 0.1067 | ||||
| 8 | 0.4261 | 0.0024 | 0.0006 | |||||
| 10 | 0.0792 | 0.052 | ||||||
| 16 | 0.8212 | |||||||
| 24 | ||||||||
| TNFα | 2 | 4 | 6 | 8 | 10 | 16 | 24 | |
| 2 | 0.2953 | 0.0987 | 0.0252 | 0.9023 | 0.6955 | 0.5087 | ||
| 4 | 0.0095 | 0.4168 | 0.5882 | 0.2381 | 0.9796 | |||
| 6 | 0.0372 | 0.3117 | 0.1469 | 0.068 | ||||
| 8 | 0.3731 | 0.1441 | 0.51 | |||||
| 10 | 0.7412 | 0.7478 | ||||||
| 16 | 0.4097 | |||||||
| 24 | ||||||||
| IL1ra | 2 | 4 | 6 | 8 | 10 | 16 | 24 | |
| 2 | 0.8337 | 0.2886 | 0.9078 | 0.6454 | 0.2457 | 0.6626 | ||
| 4 | 0.2485 | 0.8572 | 0.6258 | 0.2486 | 0.7 | |||
| 6 | 0.7178 | 0.4069 | 0.6078 | 0.2248 | ||||
| 8 | 0.6661 | 0.5646 | 0.7672 | |||||
| 10 | 0.3647 | 0.8656 | ||||||
| 16 | 0.2865 | |||||||
| 24 | ||||||||
| MRC1 | 2 | 4 | 6 | 8 | 10 | 16 | 24 | |
| 2 | 0.7488 | 0.3842 | 0.0007 | 0.5648 | 0.5007 | 0.8252 | ||
| 4 | 0.1018 | 0.0025 | 0.4226 | 0.3949 | 0.5433 | |||
| 6 | 0.0048 | 0.8499 | 0.8391 | 0.5605 | ||||
| 8 | 0.0003 | 0.0205 | 0.0083 | |||||
| 10 | 0.7647 | 0.7846 | ||||||
| 16 | 0.6493 | |||||||
| 24 | ||||||||
| ARG1 | 2 | 4 | 6 | 8 | 10 | 16 | 24 | |
| 2 | 0.0138 | <.0001 | <.0001 | 0.0004 | 0.0208 | 0.0085 | ||
| 4 | 0.0106 | 0.002 | 0.0041 | 0.4579 | 0.7186 | |||
| 6 | 0.0018 | 0.2438 | <.0001 | 0.0012 | ||||
| 8 | 0.1388 | <.0001 | <.0001 | |||||
| 10 | 0.0014 | 0.0156 | ||||||
| 16 | 0.1544 | |||||||
| 24 | ||||||||
| CD86 | 2 | 4 | 6 | 8 | 10 | 16 | 24 | |
| 2 | 0.2042 | 0.4318 | 0.9169 | 0.5731 | 0.2545 | 0.0203 | ||
| 4 | 0.8782 | 0.378 | 0.8207 | 0.8871 | 0.4193 | |||
| 6 | 0.5538 | 0.9294 | 0.8339 | 0.5795 | ||||
| 8 | 0.6455 | 0.406 | 0.1343 | |||||
| 10 | 0.8108 | 0.6164 | ||||||
| 16 | 0.76 | |||||||
| 24 | ||||||||
| TGFβ1 | 2 | 4 | 6 | 8 | 10 | 16 | 24 | |
| 2 | 0.7553 | 0.8404 | 0.02 | 0.8186 | 0.7694 | 0.2791 | ||
| 4 | 0.6795 | 0.1164 | 0.9889 | 0.8582 | 0.0118 | |||
| 6 | 0.0406 | 0.8702 | 0.9094 | 0.0356 | ||||
| 8 | 0.2138 | 0.0431 | 0.0127 | |||||
| 10 | 0.9236 | 0.1373 | ||||||
| 16 | 0.0771 | |||||||
| 24 |
| AAV injection | Soluble (pg/μg protein) | Insoluble (ng/μg protein) | ||||
|---|---|---|---|---|---|---|
| Aβ-38 | Aβ-40 | Aβ-42 | Aβ-38 | Aβ-40 | Aβ-42 | |
| GFP-AAV | 30.6 ± 12.6 | 80.4 ± 17.7 | 105.6 ± 26.8 | 204.6 ± 82.1 | 191.5 ± 62.6 | 461.8 ± 96.0 |
| IL-4-AAV | 13.2 ± 6.7 | 60.4 ± 16.3 | 45.2 ± 8.6 | 83.0 ± 45.1 | 62.6 ± 12.1 | 472.2 ± 181.5 |
| Gene | GFP-AAV | IL-4-AAV |
|---|---|---|
| IL1β | 1.20 ± 0.27 | 4.63 ± 0.67 |
| INFγ | 1.20 ± 0.39 | 1.70 ± 0.32 |
| IL6 | 1.33 ± 0.40 | 2.43 ± 0.38 |
| IL12a | 1.18 ± 0.31 | 3.60 ± 1.64 |
| TNFα | 0.74 ± 0.51 | 1.24 ± 0.15 |
| IL1ra | 1.41 ± 0.44 | 16.24 ± 3.62 |
| YM1 | 1.90 ± 1.04 | 979.43 ± 251.30 |
| ARG1 | 1.27 ± 0.40 | 216.17 ± 65.91 |
| FIZZ1 | 2.80 ± 1.74 | 767.81 ± 108.26 |
| CD86 | 1.19 ± 0.29 | 1.91 ± 0.36 |
| FCγR1 | 1.22 ± 0.33 | 1.23 ± 0.07 |
| FCγR3 | 1.15 ± 0.26 | 1.61 ± 0.17 |
| TGFβ1 | 1.21 ± 0.30 | 1.62 ± 0.28 |
| SPHK1 | 1.03 ± 0.10 | 1.61 ± 0.12 |
Discussion
Inflammation and Aβ are suggested to work both independently and synergistically, contributing to the development of AD symptoms and pathological progression [2,17-19]. It remains unknown whether inflammation has a direct or indirect effect on the acceleration of Aβ pathology, with data showing both increased and decreased amyloid deposition [20,21]. The current study aimed to characterize the M2a response stimulated by IL-4 both in vitro and in vivo. Further, we investigated the effect of an M2a phenotype on Aβ levels in the brain. The time courses of microglial morphology and phenotypic alterations in response to the application of IL-4 applied exogenously were assessed using the immortalized murine microglial cell line, BV2. In vivo, IL-4 was delivered to the brain using an AAV vector in the APP/PS1 transgenic mouse model. IL-4 is a typical inducer of an M2a phenotype [11]. An M2a phenotype was indeed induced following IL-4 application using both in vitro and in vivo approaches. The BV2 microglial cells showed a time-dependent heterogeneous phenotype with the M2a response being the most robust. These results concurred with the in vivo study; again, an evident M2a phenotype was induced with depleted Aβ deposits. Unfortunately, due to significant death in the mice receiving the IL-4 AAV, we terminated the study prematurely; thus, our measurement of Aβ deposition was restricted to biochemical outcomes.
IL-4 was selected as our stimulus for an M2a phenotype as it has been shown to be the standard stimulator of an M2a phenotype in peripheral macrophages [11]. Application of IL-4 onto BV2 cells revealed a robust time-dependent increase in M2a phenotypic markers with the vast majority showing a statistically significant peak in expression at 8 h. Overall, phenotypic expression in IL-4-induced BV2 cells strongly validates the gene screening seen in the in vivo model. In addition to the exhibition of a robust M2a state, increases in M1 and M2c could also be observed indicating an overall heterogeneous phenotype in response to the IL-4 application. This heterogeneity suggests links between these markers, emphasizing the spectral nature of microglial phenotypes and the potential interplay of the mechanistic actions of downstream pathways. Hence, further investigations are required to decipher these cascades. The time course shows that IL1β is increased in the BV2 cells in direct proportion to the increase in the IL1ra. It is possible that the increase in IL1ra is a homeostatic response to counteract amplified expression of IL1β. IL1β has a diverse range of physiological roles within the CNS [22]; therefore the benefits of complete antagonism to achieve an M1 phenotype could be detrimental to maintaining overall homeostasis within the tissue. In addition, the M2a phenotypic genes ARG1 and MRC1 both peak at 8 h. Future studies may examine other mechanisms by which we can promote an M2a response. For example, IL-13 is also an M2a-promoting cytokine, overlapping with the IL-4 pathway by dimerization of the shared IL-4Rα with IL-13Rα1 to activate a STAT-6 mechanism [23].
Immunofluorescent CD11b was used to visualize the microglial morphology at the sequential time points. CD11b is a microglial surface integrin expressed solely during activation, and it was previously indicated that disruption to homeostasis induces an “amoeboid” retraction of ramified processes, an enlarged cytoplasm, which is an indication of the activated state [24,25]. Extended filopedia can be seen up until the 6-h time point in the no-treatment control, suggesting a maintained resting state as opposed to the retracted and condensed shape compared to that of the IL-4-treated cells demonstrating activation. There is no distinct correlation between the morphology at the time points with the inflammatory profile despite the minor morphological changes discussed.
Investigation of the inflammatory profile from RT-qPCR of the right hippocampus of mice injected with IL-4 expressing AAV indicated a robust M2a phenotype with significant elevations in all inflammatory markers. Extracellular matrix remodeling proteins YM1 and FIZZ1 showed highly amplified levels reaching 500–1,000 fold. IL1ra showed a marked increase, neutralizing the role of IL1β. Congruent to the trend identified in the BV2 cells, the immune profile also exhibited increases in M1 phenotypic genes, specifically IL1β and IL-12a, suggesting a heterogeneous immune profile with chronic exposure to IL-4. Furthermore, this exemplifies the continuum of functionality in which microglia lie. It is evident that elevation of the M1 phenotype has responsive ties to that of the M2a phenotype, as seen in the BV2 cells. Phenotypic heterogeneity was further enforced by Weekman et al. [26], who revealed a mixed phenotype with IFNγ stimulation after 6 months of exposure. Unlike the BV2 cells, elevations of an M2b or M2c could not be observed in the mouse tissue.
CD11b immunohistochemistry is used to visualize activated microglia generating an indication of gliosis in a given tissue area. Astrocytes are also considered to have an immune-regulatory role. GFAP staining visualizes astrogliosis, proliferation of astrocytes in a given area. In this study, the data reveal increases in positive immunostaining in response to the AAV-IL-4 treatment, indicating a responsive proliferation of both cell subsets associated with elevated M2a phenotypic expression. Specifically, staining with CD11b revealed marked, statistically significant positive immunostaining in the dentate gyrus of the hippocampus, suggesting increased microgliosis in this region. Data from the GFAP staining also show increased immunoreactivity, but there was no statistical significance in any region of the hippocampus or frontal cortex. What is particularly intriguing is that these markers of “inflammation” that are presumed to represent proinflammatory responses are actually significantly increased in the presence of the M2a phenotype, which is often considered “antiinflammatory”. This may suggest a re-consideration in the field as to what these immunohistochemical markers functionally represent.
Data on the effect of the M2a phenotype on amyloid deposition were inconclusive. We did find a decreasing trend in Aβ levels in response to the AAV-IL-4 despite no marked statistical significance. This may have been due to the premature termination of the study. IL-4 has been studied in relation to AD pathology with mixed outcomes. Indeed, a study design very similar to the current study used AAV to overexpress IL-4 in the TgCRND8 mouse model. Here, increased amyloid deposition was observed 6 weeks post injection. Similar to the current study, enhanced GFAP and CD11b immunohistochemistry was also observed [13]. IL-4 has also been shown to attenuate Aβ-mediated neuroinflammation in a rat model [27] and promote the clearance of oligomeric Aβ by microglia in vitro [28]. The conflicting data highlight the complexities of the neuroinflammatory response and provide the rationale for further studies using better agents to chronically stimulate specific phenotypes.
Understanding the role of inflammation in Alzheimer’s disease is accelerating within the field. Yet, the direction at which to target inflammation remains a hot topic of contention. Overall, the investigation accentuates that the microglial phenotypic continuum is influenced by multitude of dimensions. This study has emphasized that intricate cytokine networks function on a time- and concentration-dependent scale. Cytokine interplay needs to be further investigated in detail to maximize the therapeutic success of immune modulation. Further studies should address the heterogeneous inflammatory profile of the AD brain at different stages of progression across all etiologies and the physiological impacts of aging on microglial ability to retain their function. In addition, the complex communications between the differing glial cells of the CNS should be acknowledged when targeting the immune response. Taken together, research in this field should move toward elucidating a personalized therapeutic approach to treating individual AD patients.
Conclusions
Our data show that IL-4 induces a robust M2a phenotype in microglial cells in both in vitro and in vivo models with implicating elevations of M1 phenotypic markers. The M2a inflammatory state is associated with increased microgliosis and astrogliosis as evidenced by increased CD11b and GFAP-positive immunostaining. Additionally, biochemical analysis shows modest reductions in soluble and insoluble Aβ lengths in APP/PS1sw transgenic mice at 3 months of age.