What this is
- This research investigates the role of miR-106b-5p in esophageal squamous cell carcinoma (ESCC).
- It focuses on how miR-106b-5p interacts with the gene, influencing cancer progression.
- The study employs various assays to analyze cell behavior and tumor growth in ESCC.
Essence
- MiR-106b-5p promotes ESCC progression by enhancing cell proliferation, migration, and invasion while inhibiting apoptosis through targeting . Silencing miR-106b-5p reduces tumor growth and metastasis in vivo.
Key takeaways
- MiR-106b-5p expression is upregulated in ESCC tissues and cell lines, contributing to increased cellular proliferation and migration.
- Silencing miR-106b-5p inhibits tumor growth and pulmonary metastasis in animal models, indicating its potential as a therapeutic target.
- acts as a tumor suppressor in ESCC, where its expression is inhibited by miR-106b-5p, leading to enhanced cancer cell survival and proliferation.
Caveats
- The study primarily focuses on cell lines and mouse models, which may not fully replicate human ESCC pathology.
- The findings are based on data from a specific patient population in China, limiting generalizability to other demographics.
Definitions
- miRNA: Small non-coding RNA molecules that regulate gene expression by binding to target mRNAs.
- HPGD: 15-hydroxyprostaglandin dehydrogenase, a gene involved in prostaglandin metabolism and identified as a potential tumor suppressor.
AI simplified
Background
Esophageal cancer (EC), a malignancy that affects the esophagus, has a five-year survival rate of less than 20% [1, 2] and has become a public health concern. Esophageal squamous cell carcinoma (ESCC) accounts for approximately 80% of ECs and constitutes the fastest-growing EC subtype in East Asia [3, 4]. Although the therapeutic strategies for ESCCs have improved, poor prognosis and treatment of patients with this cancer have become a major concern for stakeholders in the health sector [5]. In addition to chemotherapy and radiotherapy, traditional surgical techniques often fail to prevent the metastatic spread and recurrence of this cancer. Therefore, there is an urgent need to explore novel targets that may serve as effective therapeutic biomarkers for ESCC.
In this study, we sought to identify and characterize the molecules that contribute to the development of ESCC. First, we identified 15-hydroxyprostaglandin dehydrogenase (HPGD) gene located on chromosome 4q34.1 as a potential candidate. The HPGD gene consisting of 10 exons encodes an alcohol dehydrogenase protein, and participates in the metabolism of prostaglandins and in other cellular processes [6, 7]. The tumor suppressive role of HPGD has been observed in several cancers [8–10]. A previous study reported decreased expression of HPGD in ESCC tissues [11]. However, the relationship between HPGD and ESCC requires further investigation.
MicroRNAs (miRNAs) have also been linked to cancer progression. They are small single stranded non-coding RNA molecules (containing approximately 23 nucleotides) that perform their biological functions by binding to target mRNAs. As post-transcriptional regulators, miRNAs impair the stability of their target mRNAs, resulting in translational inhibition [12, 13]. Several miRNAs are associated with cancer processes, and have also been identified as potential diagnostic markers in various human cancers [14, 15]. In this study, using through bioinformatics analyses we screened two crucial miRNAs (miR-31-5p and miR-106b-5p) that may target HPGD and enable ESCC progression. According to the data from the starBase, miR-106b-5p expression is more robustly upregulated compared to that of miR-31-5p in ESCC samples, and therefore we focused on the role of miR-106b-5p in ESCC. In fact, miR-106b has been extensively studied since 2008, and many studies have shown the critical biological functions of miR-106b in tumorigenesis, such as in cell proliferation, metastasis, and apoptosis [16–18], anti-miR-106b has been proposed as a promising approach for cancer therapy [16, 19, 20]. Other cancers linked to miR-106b-5p include colorectal, breast, and gastric carcinomas [21–23]. Downregulation of miR-106b augments ESCC tumorigenesis by promoting cell proliferation and epithelial-mesenchymal transition (EMT) [24–26]. However, only one study has shown that miR-106b-5p also promotes cell migration and invasion by enhancing EMT in ESCC [25]. Other potential mechanisms underlying miR-106b-5p-mediated ESCC remain unclear.
This study aimed to investigate the role of the miR-106b-5p/HPGD axis in ESCC cell progression in vitro with the objective of providing insights for ESCC therapies.
Materials and methods
Microarray analysis
Two mRNA (GSE38129↗ and GSE17351↗) and one miRNA (GSE114110↗) expression profile was downloaded from the GEO DataSet (https://www.ncbi.nlm.nih.gov/gds/↗). GSE38129↗ included ESCC and adjacent normal samples from 30 Chinese patients, whereas GSE17351↗ included ESCC and adjacent normal samples from five American patients. With adjusted P-value (adj. P) < 0.05, and log fold change (logFC) < − 1, the differentially expressed genes (DEGs) were screened using the limma 3.26.8 package. For the miRNAs, Limma 3.26.8 was applied to analyze the differentially expressed miRNAs in ESCC with adj. P < 0.05, and logFC > 1. Metascape (https://metascape.org/gp/index.html↗) was used to analyze the key biological processes associated with these DEGs. Their expression in normal and esophageal carcinoma (ESCA) tissues was analyzed using UALCAN, with data obtained from the cancer genome atlas (TCGA). StarBase (http://starbase.sysu.edu.cn↗) was used to analyze miRNA expression in ESCA tissues and to predict the miRNAs that bind to HPGD. TargetScan was also used to predict the miRNAs that could bind to HPGD. Finally, DEGs and miRNAs were overlapped using the Venny 2.1.0.
Tissue samples and cell lines
Human ESCC cell lines (KYSE30, KYSE180, KYSE450, and KYSE510) and normal esophageal epithelial cells (Het-1A) were purchased from ATCC (Manassas, VA, USA). All cell lines used in this study were cultured in Dulbecco’s modified Eagle’s medium (DMEM; Cat#: A4192101, Gibco, Waltham, MA, USA) containing 10% fetal bovine serum (Cat#: 10099141, Gibco) and incubated at 37 °C in an incubator containing 5% CO2.
| Characteristics | = 45N | miR-106b-5p expression | P | HPGD expression | P | ||
|---|---|---|---|---|---|---|---|
| Low (23) | High (22) | Low (23) | High (22) | ||||
| Gender | 0.181 | 0.626 | |||||
| Male | 27 | 16 | 11 | 13 | 14 | ||
| Female | 18 | 7 | 11 | 10 | 8 | ||
| Age (years) | 0.349 | 0.758 | |||||
| > 50 | 24 | 15 | 9 | 11 | 13 | ||
| ≤ 50 | 21 | 8 | 13 | 12 | 9 | ||
| Histology differentiation | 0.018 | 0.013 | |||||
| Poorly | 14 | 3 | 11 | 8 | 6 | ||
| Middle | 22 | 13 | 9 | 7 | 15 | ||
| Well | 9 | 7 | 2 | 8 | 1 | ||
| Weight loss | 0.302 | 0.167 | |||||
| > 5% | 19 | 8 | 11 | 12 | 7 | ||
| ≤ 5% | 26 | 15 | 11 | 11 | 15 | ||
| TNM stage | 0.014 | 0.013 | |||||
| Stage I | 15 | 12 | 3 | 3 | 12 | ||
| Stage II | 21 | 9 | 12 | 14 | 7 | ||
| Stage III | 9 | 2 | 7 | 6 | 3 | ||
| KPS | 0.048 | 0.017 | |||||
| > 90 | 29 | 18 | 11 | 11 | 18 | ||
| 70–90 | 16 | 5 | 11 | 12 | 4 | ||
RNA isolation and RT-qPCR
| GENE | Primer sequences (5′-3′) |
|---|---|
| miR-106b-5p | Forward: TGCGGCAACACCAGTCGATGG |
| Reverse: CCAGTGCAGGGTCCGAGGT | |
| U6 | Forward:ATTGGAACGATACAGAGAAGATT |
| Reverse:GGA ACGCTTCACGAATTTG | |
| HPGD | Forward: CTCTGTTCATCCAGTGCGAT |
| Reverse: CTCCCGAGTAAAGGACCCACA | |
| MAL | Forward: TCTTTTACCTCAGCGCCTCA |
| Reverse: CGGCCAGTTAACACCATCTG | |
| GAPDH | Forward: AGCCACATCGCTCAGACAC |
| Reverse: GCCCAATACGACCAAATCC |
Cell transfection
MiR-106b-5p inhibitor, miR-106b-5p mimic, and their corresponding negative controls, were purchased from Shanghai Tuoran Co., Ltd. The corresponding sequences are listed in the Supplemental Table 1. A full-length HPGD cDNA was synthesized (Shanghai Tuoran Co. Ltd.) and cloned into pcDNA3.1 plasmid. Puromycin (4 μg/mL) was used to select stably transfected cells. KYSE450 and KYSE510 cells (3 × 105 cells) were transfected with 50 nM miR-106b-5p inhibitor, miR-106b-5p mimic, or miR-NC using Lipofectamine 3000 Reagent (Invitrogen, Waltham, MA, USA). The cells were cultured for 48 h before performing subsequent experiments as described previously [28].
Cell counting Kit-8 (CCK-8) assay
CCK-8 assay was performed to investigate cell viability [29] (Cat#: K1018; APExBIO, China). Briefly, KYSE450 and KYSE510 cells (3 × 103 cells) were seeded in a 96-well plate. At the indicated times, CCK-8 (10 μL) reagent was added to the wells with cells, and the cells were incubated further for 2 h. Finally, the optical density (OD) was measured at 450 nm with a multimode-plate-reader (Tecan, Switzerland).
BrdU assay
BrdU assay was performed according to a previously reported method [30]. First, KYSE450 and KYSE510 cells (3 × 103 cells) were cultured in 96-well plates for 24 h followed by 12 h of serum starvation. After another 8 h, serum was added back to the cells. The BrdU Cell Proliferation Assay Kit (Cat#: 6813, CST, Danvers, MA, USA) was used to label cells for 8–12 h without removing the treatment media. Finally, the OD was measured at 450 nm.
Cell adhesion assay
Cell adhesion assays were performed based on the methodology used in a previous study [22]. KYSE450 and KYSE510 cells (3 × 103 cells) were cultured in 96-well plates. Collagen I solution (40 μg/mL; Cat#: C7661, Sigma-Aldrich, St. Louis, MO, USA) was added to the wells and the plates were stored overnight at 4 °C. The transfected cells were cultured in serum-free DMEM for 8 h. Cells were treated with 10 mM EDTA (in DMEM) for 10 min to dissociate them from the dishes. After collecting and resuspending the cells in DMEM with 0.1% BSA (2 × 105 cells/mL), the cells suspension (100 μL) was added to a air-dried 96-well plate for another 30 or 60 min. After incubation, 100 μL DMEM was added to remove the non-adherent cells and the dishes were further incubated for 4 h. Subsequently, the MTT substrate (Cat#: CT01, Sigma) (10 μL/well) was applied to the treated cells for 2 h at 30 °C. Next, 100 μL of DMSO was added to each well containing the lysed cells. Finally, the absorbance was measured at 570 nm.
Colony formation assay
Cells were disassociated, suspended, and plated in a 6-well culture plate at a density of 100 cells/well. After culturing for 14 days at 37 °C, the cells were washed twice with PBS and stained with Giemsa solution. Colonies larger than 75 μm in diameter or containing more than 50 cells were counted as a positive colony.
Wound healing assay
Cells were plated in a 6-well plate and once they reached more than 90% confluence, the cell monolayer was scratched with a 200 μL pipette tip to produce a wound. After removing the floating cells, fresh medium (without serum) was added to the wells and the cells were cultured at 37 °C for 24 h. Images of cells at the same location were captured at 0 h and 24 h using an Olympus IX51 inverted microscope (Olympus, Tokyo, Japan), and the wound healing rate was calculated as percent wound width covered = (width at 0 h - width at 24 h)/width at 0 h × 100%.
Cell invasion assay
Transwell inserts coated with Matrigel (40 μg/well, BD Biosciences, San Jose, CA, USA) were used to assess cell invasion. Cells (2 × 105) in serum-free medium were added to the upper chamber of the Transwell, and 600 μL of medium containing 10% FBS was added to the lower chamber. After 48 h of culture at 37 °C, the cells that had penetrated the membrane and adhered to the surface of the lower membrane were fixed with methanol, stained with Giemsa, and photographed under a light microscope (Leica Microsystems, Wetzlar, Germany).
Cell cycle analysis
Cells were collected 48 h after transfection and fixed overnight in 70% ethanol at 4 °C. Next, the DNA was stained using a cell cycle detection kit (KeyGen, Nanjing, China). Briefly, the cells were treated with RNase A and stained with 50 μg/mL propidium iodide. The DNA content was analyzed by flow cytometry using a FACS Calibur system (Becton Dickinson, Franklin, NJ, USA). Data were collected and processed using FlowJo FACS analysis software (Tree Star, Ashland, OR, USA).
Caspase-3/7 activity assay
The apoptotic ability of ESCC cells was assessed using the caspase-3/7 Assay Kit (Cat#: G8090, Promega, Madison, Wisconsin, USA) as described previously [27]. According to the manufacturer’s guidelines, both the ESCC cell lines (3 × 103 cells) were cultured in 96-well plates. Next, the detection solution was prepared, and caspase 3/7 buffer was added to the bottle containing the caspase 3/7 substrate. After adding the mixed solution (100 μL/well) to the 96-well plate containing cells at 80% cell density, the mixture was incubated at room temperature for 2 h. Finally, OD values were measured at 450 nm.
Animal studies
Five-week-old female nude mice (5-weeks old) purchased from Shanghai SIPPR-BK Laboratory Animal Co. Ltd. (Shanghai, China) for the in vivo studies. Animal experiments were carried out in strict accordance with the Regulations for the Administration of Affairs Concerning Experimental Animals. KYSE510 cells (2 × 106) from the inhibitor-NC and miRNA inhibitor transfected groups were collected and resuspended in 2 mL PBS. Cells were injected subcutaneously into the backs of the nude mice. Tumor size was measured with calipers every fifth day. The tumor volume (V) was calculated using the following formula: V = length × Width2 × 1/2. All the mice were euthanized 25 days after implantation by asphyxiation with carbon dioxide. The mice were placed into the euthanasia chamber and filled with CO2 at 30% chamber volume /min. When the mice were unconscious and stopped breathing, the CO2 flow was maintained for 1 min. The mice death was confirmed as cardiac arrest and did not respond to the toe-pinching reflex [28]. Tumors from the resected mice were weighed and photographed immediately.
The lung tissues were resected, fixed in 10% formaldehyde solution, dehydrated in an ethanol gradient, embedded in paraffin, and cut into slices of 4 μm thickness. After deparaffinization, the samples were stained with haematoxylin and eosin. The slices were then mounted and observed under a light microscope (Leica Microsystems).
Luciferase assay
The pmiRGLO-HPGD3′-UTR-Wt and pmiRGLO-HPGD3′-UTR-mutated vectors were constructed by Guangzhou Boxin Biotechnology Co. Ltd. (China). KYSE450 and KYSE510 cells (3 × 105 cells) were co-transfected with pmiRGLO HPGD 3′-UTR-Wt or HPGD 3’UTR-Mut and either miR-NC or miR-106b-5p. At post 48 h post-transfection, luciferase was assessed with the Luciferase Assay Kit (Cat#: #16185, Thermo Scientific, Waltham, MA, USA) according to the manufacturer’s instructions and normalized to the firefly luciferase levels used as an internal control.
RNA pull down assay
Biotin-labeled negative control (Bio-NC) and miR-106b-5p (Bio-miR-106b-5p) used in this study were provided by RiboBio (China). The two Bio-miRNA mimics were first transfected into KYSE450 and KYSE510 cells. After for 48 h lysis buffer supplemented with the protease and RNase inhibitors was added to the cells. Streptavidin beads (Cat#: #88817, Thermo Scientific) were washed and added to the cell lysates. The cells were incubated overnight at 4 °C. Subsequently, the beads were washed twice, and the RNA was eluted and purified using the RNeasy Mini Kit (Cat#: 74104, QIAGEN, Germany). Finally, HPGD enrichment was detected by RT-qPCR analysis.
Western blotting analysis
Proteins from the cells were denatured and quantified. First, proteins (30 μg) were separated on a 10% sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) gel. Next, the gels were electroblotted onto polyvinylidene difluoride (PVDF) membranes for hybridization. After blocking with 5% milk, the membranes were incubated with the following antibodies: anti-HPGD (1:1000, Cat#: ab187160, Abcam, UK), anti-Bax (1:2000, Cat#: ab32503, Abcam), anti-Bcl-2 (1:2000, Cat#: ab182858, Abcam), and β-actin (1:2000, Cat#: ab8226, Abcam) overnight at 4 °C. Then, the membranes were incubated with the corresponding secondary antibodies; goat anti-rabbit IgG H&L (HRP) (1:10000, Cat#: ab97051, Abcam) for HPGD and goat anti-mouse IgG H&L (HRP) (1:10000, Cat#: ab175783, Abcam, UK) for β-actin, at room temperature for 3 h. Next, ECL reagents (Bio-Rad, California, USA) were used to detect the protein bands. Finally, the density in each band was quantified using Image J software (ImageJ 1.48v, NIH, Maryland, USA).
Statistical analysis
Experimental data presented as the means ± standard deviation (SD) were analyzed using the paired Student’s t-tests for two-group comparisons and one-way ANOVA with Dunnett’s post hoc for multiple group comparisons using SPSS software (version 19.0; IBM Corp., Armonk, NY, USA). Three independent repeats were performed for each experiment. Significance was set at p < 0.05.
Results
Involvement of HPGD and miR-106b-5p in ESCC
HPGD and miR-106b-5p were selected to be further investigate in ESCC by microarray analysis.85 DEGs were overlapped fromandby Venny 2.1.0.andwere the mRNA expression profiles.The positive regulation of cell death containing 9 DEGs was screen out as the key progress by Metascape analysis.The expression of HPGO and MAL in ESCA was significant reduced.The expression of HPGO and MAL was detected in the ESCC tissue samples (= 45) and normal tissues (= 45) by qRT-PCR.miR-106b-5p and miR-31-5p were overlapped from, TargetScan, and starBase.was the miRNA expression microarray. TargetScan and starBase were used to predict the miRNAs targeting HPGD.The expression of miR-106b-5p was significant down-regulated in ESCA by starBase analysis A B C D E F GSE38129 GSE17351 GSE38129 GSE17351 GSE114110 GSE114110 n n
High expression of miR-106b-5p in ESCC
MiR-106b-5p was upregulated in ESCC tissues.RT-qPCR detection of miR-106b-5p expression in ESCC tissues (= 45) and normal tissues (= 45). **,< 0.001 compared to normal tissues.Measurement of miR-106b-5p expression in ESCC cells lines (KYSE30, KYSE180, KYSE450, and KYSE510) and normal esophageal epithelial cells (Het-1A). Data are presented as means± SD of at least three independent tests per experiment. **,< 0.001 compared to Het-1A cells A B n n P P
Promotion of ESCC progression by miR-106b-5p
MiR-106b-5p promoted cell proliferation, adhesion, colony formation, migration and invasion in ESCC.Measurement of miR-106b-5p expression in KYSE450 and KYSE510 cells transfected with NC, miR-106b-5p mimic, and miR-106b-5p inhibitor with RT-qPCR.Cell viability was detected in KYSE450 and KYSE510 cells transfected with miR-106b-5p mimic, and miR-106b-5p inhibitor by CCK-8 assay.Cell proliferation was detected in KYSE450 and KYSE510 cells transfected with, miR-106b-5p mimic, and miR-106b-5p inhibitor by BrdU assay.Cell adhesion was detected in KYSE450 and KYSE510 cells transfected with NC, miR-106b-5p mimic, and miR-106b-5p inhibitor by cell adhesion assay kit.Cell colony formation was detected in KYSE450 and KYSE510 cells transfected with NC, miR-106b-5p mimic, and miR-106b-5p inhibitor by colony formation assay.Cell migration rate was detected in KYSE450 and KYSE510 cells transfected with NC, miR-106b-5p mimic, and miR-106b-5p inhibitor by cell wound healing assay.Cell invasion was detected in KYSE450 and KYSE510 cells transfected with NC, miR-106b-5p mimic, and miR-106b-5p inhibitor by transwell assay. Data are presented as means± SD of at least three independent tests per experiment. *,< 0.05; **,< 0.001 compared to CON group. CON, blank control; NC, mimic-NC + inhibitor-NC A B C D E F G P P
MiR-106b-5p promoted cell cycle progression and suppressed cell apoptosis in ESCC.Cell cycle was detected in KYSE450 and KYSE510 cells transfected with NC, miR-106b-5p mimic, and miR-106b-5p inhibitor by flow cytometry assay.Cell apoptosis rate was detected in KYSE450 and KYSE510 cells transfected with NC, miR-106b-5p mimic, and miR-106b-5p inhibitor by flow cytometry assay.Cell apoptosis was determined in KYSE450 and KYSE510 cells transfected with NC, miR-106b-5p mimic, and miR-106b-5p inhibitor by caspase-3/7 activity assay kit.The protein expression of Bax and Bcl-2 were determined in KYSE450 and KYSE510 cells transfected with NC, miR-106b-5p mimic, and miR-106b-5p inhibitor by western blot analysis. Data are presented as means± SD of at least three independent tests per experiment. *,< 0.05; **,< 0.001 compared to CON group. CON, blank control; NC, mimic-NC + inhibitor-NC A B C D P P
Inhibition of miR-106b-5p reduced the growth of ESCC xenografts and pulmonary metastasis
MiR-106b-5p promoted s xenograft and pulmonary metastasis in ESCC.Tumor growth curves measured after the inoculation of nude mice injected with KYSE510 cells transfected with inhibitor-NC, and miR-106b-5p inhibitor.Photographs of tumors in nude mice injected with KYSE510 cells transfected with inhibitor-NC, and miR-106b-5p inhibitor.Representative photographs of H&E stained spontaneous lung metastases in nude mice injected with KYSE510 cells transfected with inhibitor-NC, and miR-106b-5p inhibitor A B C
Effect of miR-106b-5p on HPGD expression
HPGD was a direct target ofmiR-106b-5p.Bioinformatics analysis showed the predicted binding sequence of HPGD 3’-UTR.Dual luciferase assay was performed in cells co-transfected with plasmids HPGD-Wt or HPGD-Mut and miR-NC or miR-106b-5p mimic in KYSE450 and KYSE510 cells. **,< 0.001 compared to co-transfection of HPGD-Wt and miR-NC group.RNA pull down assay was used to detect the association between HPGD and miR-106b-5p in KYSE450 and KYSE510 cells. **,< 0.001 compared to Bio-NC group.RT-qPCR detection of expression of HPGD in Het-1A, KYSE450 and KYSE510 cells. **,< 0.001 compared to Het-1A cells.Western blot detection of protein expression of HPGD in Het-1A, KYSE450 and KYSE510 cells. Data are presented as means ± SD of at least three independent tests per experiment. *,< 0.05; **,< 0.001 compared to Het-1A cells. Wt, wild-type; Mut, mutant; NC, negative control A B C D E P P P P P
Promotion of ESCC progression by miR-106b-5p/HPGD axis
MiR-106b-5p targeting to HPGD promoted proliferation, adhesion, colony formation, migration and invasion of ESCC cells.Measurement of HPGD and miR-106b-5p gene expression in KYSE450 and KYSE510 cells transfected with NC, OE-HPGD, miR-106b-5p mimic, and OE-HPGD+miR-106b-5p mimic by RT-qPCR.Measurement of HPGD protein expression in KYSE450 and KYSE510 cells transfected with NC, OE-HPGD, miR-106b-5p mimic, and OE-HPGD+miR-106b-5p mimic by western blot.Cell viability was detected in KYSE450 and KYSE510 cells transfected with NC, OE-HPGD, miR-106b-5p mimic, and OE-HPGD+miR-106b-5p mimic by CCK-8 assay.Cell proliferation was detected in KYSE450 and KYSE510 cells transfected with NC, OE-HPGD, miR-106b-5p mimic, and OE-HPGD+miR-106b-5p mimic by BrdU assay.Cell adhesion was detected in KYSE450 and KYSE510 cells transfected with NC, OE-HPGD, miR-106b-5p mimic, and OE-HPGD+miR-106b-5p mimic by cell adhesion assay kit.Cell colony formation was detected in KYSE450 and KYSE510 cells transfected with NC, OE-HPGD, miR-106b-5p mimic, and OE-HPGD+miR-106b-5p mimic by colony formation assay.Cell migration rate was detected in KYSE450 and KYSE510 cells transfected with NC, OE-HPGD, miR-106b-5p mimic, and OE-HPGD+miR-106b-5p mimic by cell wound healing assay.Cell invasion was detected in KYSE450 and KYSE510 cells transfected with NC, OE-HPGD, miR-106b-5p mimic, and OE-HPGD+miR-106b-5p mimic by transwell assay. Data are presented as means± SD of at least three independent tests per experiment. *,< 0.05; **,< 0.001 compared to CON group. CON, blank control; NC, empty vectors+mimic-NC; OE-HPGD, overexpression-HPGD; OE-HPGD+miR-106b-5p mimic, overexpression-HPGD+ miR-106b-5p mimic A B C D E F G H P P
MiR-106b-5p targeting to HPGD promoted cell cycle progression and suppressed cell apoptosis of ESCC cells.Cell cycle was detected in KYSE450 and KYSE510 cells transfected with NC, OE-HPGD, miR-106b-5p mimic, and OE-HPGD+miR-106b-5p mimic by flow cytometry assay.Cell apoptosis rate was detected in KYSE450 and KYSE510 cells transfected with NC, OE-HPGD, miR-106b-5p mimic, and OE-HPGD+miR-106b-5p mimic by flow cytometry assay.Cell apoptosis was determined in KYSE450 and KYSE510 cells transfected with NC, OE-HPGD, miR-106b-5p mimic, and OE-HPGD+miR-106b-5p mimic by caspase-3/7 activity assay kit.The protein expression of Bax and Bcl-2 were determined in KYSE450 and KYSE510 cells transfected with NC, OE-HPGD, miR-106b-5p mimic, and OE-HPGD+miR-106b-5p mimic by western blot analysis. Data are presented as means± SD of at least three independent tests per experiment. *,< 0.05; **,< 0.001 compared to CON group. CON, blank control; NC, empty vectors+mimic-NC; OE-HPGD, overexpression-HPGD; OE-HPGD+miR-106b-5p mimic, overexpression-HPGD+ miR-106b-5p mimic A B C D P P
Discussion
MiR-106b-5p has been implicated in several types of cancers [22, 29]. In this study, we provide data to support that miR-106b-5p has a tumor-promoting effect and mediates tumor progression. Using bioinformatics analysis, we first identified miR-31-5p and miR-106b-5p as two potential miRNAs that target HPGD and participate in ESCC. Because of its higher differential expression in ESCC tissues compared to miR-31-5p, we further investigated the function of miR-106b-5p. Our findings showed an increase in miR-106b-5p expression and a decrease in HPGD expression in ESCC samples. In addition, miR-106b-5p inhibited the expression of HPGD at both mRNA and protein levels. In addition, miR-106b-5p promoted proliferation, colony formation, adhesion, migration, and invasion, and induced cell cycle, but inhibited apoptosis of ESCC cells. Silencing of miR-106-5p inhibited tumor growth and lung metastasis in vivo.
A previous study documented the ability of miR-106b-5p to inhibit the invasion and metastasis of colorectal cancer (CRC) cells [17]. In another study, low expression of miR-106b-5p correlated with poor survival of patients with CRC [21]. Only a single study reported that miR-106b-5p promotes cell migration and invasion via enhancement of EMT by targeting SMAD family member 7 (Smad7) [25]. As cell viability, proliferation, adhesion, and apoptosis were the key characteristics of cancer cells [22, 30, 31], we evaluated these cellular functions through a series of assays. Consistently, upregulation of miR-106b-5p was observed in ESCC tissues and cells that promoted the progression of ESCC by enhancing the viability, proliferation, colony formation, adhesion, migration, and invasive ability of the cells, and induced cell cycle progression and suppressed apoptosis of ESCC cells. We also showed that silencing of miR-106-5p inhibited tumor growth and lung metastasis in vivo.
Several studies have demonstrated that HPGD functions as a tumor suppressor gene in various cancers [8–10]. The downregulation of HPGD caused by activation of interleukin-1β led to a poor prognosis in pancreatic cancer patients, and reduction of HPGD expression was associated with tumorigenesis [8]. In the context of breast cancer, HPGD acts as a tumor suppressor, and the upregulation of HPGD was found to reduce tumorigenesis in athymic mice [9]. Another study showed that HPGD expression and activity was decreased in CRC tissues [10]. However, a previous studies reported a decrease in HPGD expression in ESCC tissues [11], and in an isolated human metastasizing esophageal cancer cell line [32], suggesting that HPGD may contribute to ESCC development. Based on previous studies and our bioinformatics analysis, we suspected that HPGD was a potential tumor suppressor gene in ESCC and that miR-106b-5p may bind to the 3’UTR of HPGD to regulate ESCC progression. Cytological assays revealed that miR-106b-5p contributed to the progression of ESCC by enhancing cell proliferation, colony formation, adhesion, migration, and invasion, and induced cell cycle progression, while inhibiting cell apoptosis. In addition, a previous study demonstrated that HPGD suppresses colon cancer aggressiveness through the STAT3 and AKT pathways [33]. Therefore, future studies should investigate this pathway to confirm this interaction in ESCC.
Several studies have shown that each miRNA targets multiple mRNAs [34]. Furthermore, miR-106b-5p has been reported to target different mRNAs in a variety of cancers. For example, Gao et al. [35] found that miR-106b-5p regulates the growth of clear cell renal cell carcinoma by targeting PDCD. Another study revealed that miR-106b-5p regulates the migration and invasion of CRC cells by targeting FAT4 [36]. Therefore, in future research, we need to further study other mRNA targets that are regulated by miR-106b-5p in ESCC, to better understand the miRNA-mRNA regulatory networks in ESCC.
Immortalized cell lines and primary cells are indispensable tools in the study of cancer pathogenesis and have been shown to share similar pathophysiological changes [37]. However, some studies have found that there are some differences between cell lines and primary cells in their protein properties, morphology, and metabolic activity [38]. Therefore, it is necessary to isolate and culture primary cancer cells from tumor tissues of ESCC patients to further understand the effects of miR-106b-5p/HPGD in ESCC. In addition, the epidemiology and pathogenesis of ESCC varies worldwide [39]. Our study only investigated the association between the expression of miR-106b-5p and HPGD, and the characteristics of patients from China. To identify biomarkers of ESCC, the association between the expression of miR-106b-5p and HPGD and characteristics needs to be analyzed in patients from different parts of the world.
Conclusion
In summary, our data suggest that miR-106b-5p and HPGD affect ESCC progression. More specifically, our findings indicated that miR-106b-5p accelerates proliferation, colony formation, adhesion, migration, invasion, and induces cell cycle progression, but represses apoptosis in vitro by targeting HPGD. In vivo, silencing of miR-106b-5p inhibits tumor growth and lung metastasis. Thus, miR-106b-5p and HPGD represent promising targets for the diagnosis and treatment of ESCC.
Supplementary Information
Additional file 1: Supplemental Figure 1. The measurement of miR-106b-5p expression in KYSE450 and KYSE510 cells transfected with mimic-NC and/or inhibitor-NC, miR-106b-5p mimic or miR-106b-5p mimic by RT-qPCR. Data are presented as means± SD of at least three independent tests per experiment. *, P < 0.05; **, P < 0.001 compared to CON group. CON, blank control; mimic-NC, miRNA mimic corresponding negative control; inhibitor-NC, miRNA inhibitor corresponding negative control; co-NC, mimic-NC + inhibitor-NC; miRNA mimic, miR-106b-5p mimic; miRNA inhibitor, miR-106b-5p inhibitor. Supplemental Figure 2. (A) Measurement of HPGD mRNA expression in KYSE450 and KYSE510 cells transfected with empty vector and/or mimic-NC or OE-HPGD by RT-qPCR. (B) Measurement of HPGD protein expression in KYSE450 and KYSE510 cells transfected with empty vector and/or mimic-NC or OE-HPGD by western blot. Data are presented as means± SD of at least three independent tests per experiment. *, P < 0.05; **, P < 0.001 compared to CON group. CON, blank control; empty vecor, pcDNA3.1 empty vector; mimic-NC, miRNA mimic corresponding negative control; co-NC, empty vector+mimic-NC; OE-HPGD, overexpression-HPGD.Additional file 2: Supplemental Table 1. Sequences for cell transfection.