What this is
- () impairs cognitive function in mice, linked to mitochondrial dysfunction and inflammation.
- (SS-31), a mitochondrion-targeted antioxidant, was tested for its ability to counteract these effects.
- The study finds that SS-31 improves cognitive deficits by restoring mitochondrial function and reducing inflammation.
Essence
- (SS-31) improves cognitive impairment caused by in mice by enhancing mitochondrial function and reducing inflammation.
Key takeaways
- SS-31 treatment reversed recognition memory deficits induced by , as shown in the novel object recognition test.
- In the Morris water maze test, SS-31 decreased escape latency and distance traveled in mice subjected to sleep deprivation, indicating improved spatial learning and memory.
- SS-31 restored levels of key proteins associated with mitochondrial function and synaptic plasticity, including and brain-derived neurotrophic factor (BDNF), which were altered by .
Caveats
- The study focused solely on male mice, limiting the generalizability of findings regarding sex differences in response to sleep deprivation.
- Mitochondrial function and oxidative stress were not fully evaluated, leaving gaps in understanding the mechanisms of SS-31's effects.
Definitions
- Chronic sleep deprivation (CSD): Extended periods of inadequate sleep, leading to cognitive deficits and physiological stress.
- Elamipretide (SS-31): A mitochondrion-targeted antioxidant that improves mitochondrial function and reduces inflammation.
- SIRT1: A protein that regulates cellular processes including metabolism and inflammation, linked to mitochondrial health.
AI simplified
INTRODUCTION
Sleep is a conserved biological behavior in mammals. Classical theories posit that sleep is driven by two major factors: (I) a homeostatic mechanism controlled by sleepâpromoting substances, including adenosine and prostaglandin E; and (II) a circadian clock that is mainly regulated by the suprachiasmatic nucleus and other rhythmic nuclei (Chung et al., 2017; Huang et al., 2014; Weber & Dan, 2016). The daily variations during rest and activity periods are regulated by homeostasis and rhythm but are highly susceptible to external interference. Accumulating evidence indicates that adequate sleep is conducive to removing brain waste products, energy recovery, and memory consolidation (Stickgold & Walker, 2005; Xie et al., 2013). With the development of society, the prevalence of sleep dysfunction has increased in many populations, mostly due to coffee abuse, electronic devices use, and heavy workloads, which in turn increases the risk of neurological and psychotic disorders, including anxiety, depression, and cognitive impairment (Cai et al., 2022; Xie et al., 2020; Yang et al., 2023).
Given the wellâknown cognitive effects and increasing prevalence of sleep dysfunction in society, investigating the mechanism underlying sleep deprivation (SD)âinduced cognitive deficits has become a research hotspot. Previous studies on the mechanisms underlying the cognitive impairment associated with SD largely focused on changes in synaptic proteins, synaptic plasticity, the inflammatory response, and neurotransmitters. For example, acute SD for 48 h induced by an automated cageâshaking stimulus resulted in location recognition memory impairment and reduced protein expression levels of synaptophysin (SYN), synapsin, and postsynaptic densityâ95 (PSDâ95) in the hippocampus of rats (Wadhwa et al., 2015). Nuclear factor kappaâB (NFâÎșB) is a classic inflammatory regulator and its activation leads to the release of proâinflammatory cytokines, including interleukin (IL)â1ÎČ, ILâ6, and tumor necrosis factorâalpha (TNFâα). Chronically repeated paradoxical SD for 3 months significantly increased NFâÎșB activity and the level of TNFâα in the hippocampus, leading to anxiety and working memory dysfunction in mice (Yin et al., 2017). However, research in this field to date has neglected the influences of SD on the intrinsic properties of neurons.
Growing evidence suggests that mitochondrial dysfunction is involved in the cognitive dysfunction induced by SD. In addition to their primary function as intracellular organelles within neurons responsible for producing adenosine triphosphate (ATP), the mitochondria also perform other essential cellular functions, including regulating the inflammatory response, synaptic plasticity, energy metabolism, production and elimination of reactive oxygen species (ROS), and cell survival and death (Ahmad et al., 2023; Chen et al., 2023). SD was reported to impair the mitochondrial electron transport system, accompanied by an increase in ROS production and lipid peroxidation (Rodrigues et al., 2018). Paradoxical SD decreased the membrane excitability of CA1 pyramidal neurons by translocating Bax to the mitochondria and releasing cytochrome C into the cytoplasm (Yang et al., 2008). In view of the above evidence, it appears possible that the inflammation, synaptic dysfunction, and cognitive impairment induced by SD could be improved by pharmacological methods targeting damaged mitochondria.
Elamipretide (SSâ31; dâArgâdimetthylâTyrâLysâPheâNH2) is a mitochondrionâtargeted antioxidant discovered by Hazel Szeto and Peter Schiller. Owing to its aromatic cationic structure, SSâ31 can freely cross the bloodâbrain barrier and cell membrane, ultimately reaching a concentration of more than 1000 times in the mitochondria independent of mitochondrial membrane potential (Petri et al., 2006; Szeto, 2008; Siegel et al., 2013). SSâ31 has been found to scavenge various mitochondrial ROS, improve ATP production, prevent mitochondrial swelling, and decrease the inflammatory response by binding to mitochondrial cardiolipin (Birk et al., 2013; Hao et al., 2015). Furthermore, SSâ31 was reported to activate the downstream signaling pathways related to peroxisome proliferatorâactivated receptor Îł coâactivator alpha (PGCâ1α), a master regulator of mitochondrial activity that is involved in regulating mitochondrial biogenesis and function, by modulating sirtuin 1 (SIRT1) levels (EscribanoâLopez et al., 2018). SSâ31 has already been shown to act as a protective factor in models of ischemia, sepsis, and traumatic brain injury by reversing mitochondrial function (Cai et al., 2018; Wu, Zhang, et al., 2015; Zhu et al., 2018). However, the potential protective effects of SSâ31 on chronic sleep deprivation (CSD)âinduced learning and memory impairment and underlying mechanisms remain unclear.
We hypothesized that SSâ31 would improve the inflammatory response and synaptic dysfunction induced by CSD by repairing mitochondrial function to ultimately alleviate the cognitive deficits. To test this hypothesis, we created a mouse model of CSD and examined the effects of SSâ31 administration on learning and memory function, markers of mitochondrial and synaptic function, and proinflammatory cytokines.
MATERIALS AND METHODS
Animals
Male 2âmonthâold C57BL/6J mice were obtained from Beijing Vital River Laboratory Animal Technology Co., Ltd. (specific pathogenâfree grade). The animals are kept in an environment where food and water are available ad libitum, with a 12âh darkâlight cycle, 21â23°C temperature and 50%â60% relative humidity.
Experimental protocols
The male C57BL/6J mice were randomly allocated to one of the following four groups (n = 8 per group): Control + saline, Control + SSâ31, SD + saline, and SD + SSâ31. SSâ31 or saline (5 mg/kg) was administered intraperitoneally to the mice 30 min prior to sleep deprivation using an adapted version of the BWâNSD404 sleep deprivation machine (Shanghai Bioâwill Co., Ltd.). The principle of the machine is to place the mouse on a platform that is constantly moving to prevent the mouse from falling asleep (Zhang, Cheng, et al., 2022). After administration of SSâ31 or saline, the mice in the SD + SSâ31 and SD + saline groups were subjected to the sleep deprivation machine for 21 consecutive days from 2:00 p.m. to the following day at 8:00 a.m. (Konakanchi et al., 2023), whereas mice in the Control + saline and Control + SSâ31 groups were maintained on the static (not moving) machine during this same period (see Figure 1).

Experimental protocol. MWM, Morris water maze test; NOR, novel object recognition; SD, sleep deprivation.
Novel object recognition test
The new object experiment was used to assess shortâterm cognitive function in mice. As previously performed by others (Leger et al., 2013), the experiment was divided into three parts: habituation, familiarization, and test phases. In the habituation phase, mice were placed in an empty open field and explored freely for 5 min. A period of 24 h later, mice were placed in an open field containing two identical objects for familiarization, and the experiment was discontinued when both objects had been explored for 20 s or when the 10âmin had expired. During the test phase, one of the objects in the open field was replaced with a new object and the mice were allowed to explore the old (D1) and new objects (D2) freely with 10 min. A 75% alcohol was used at the end of each experiment to eliminate the effect of odor. The memorization ability was quantified by novel object recognition index (NOI): NOI = D2/(D1 + D2).
Morris water maze test
To avoid the influence of the novel object recognition test on the subsequent Morris water maze test, the Morris water maze test was conducted on a new cohort of the mice. The protocol used in this study was similar to the one previously described and was used to assess the spatial learning and memory abilities of mice (Zhang, Cheng, et al., 2022). The test was divided into a learning phase and a memory phase. During the learning phase, mice were trained in a circular white pool with a diameter of 120 cm and a height of 30 cm. Each mouse performed four trials per day to find the hidden target platform and was allowed to rest on the platform for 30 s whether or not they found the hidden platform within 60 s. The learning phase lasted for a total of 7 days. The target underwater platform was removed 2 h after the last experiment on the last day of the learning phase. During the memory phase, after the hidden platform was removed, the mice entered the water from the opposite quadrant of the quadrant where the target platform was located and explored freely for 60 s. ANYâmaze tracking system was used for recording and analysis of all trials.
Reverse transcriptionâfluorescence quantitative polymerase chain reaction (RTâPCR)
Total RNA was extracted from the hippocampal tissue by adding Trizol lysate. Spectrophotometer was used to assess the purity of the extracted RNA. The RNA was reverseâtranscribed to cDNA using the PrimeScript reverse transcription (RT) reagent Kit with gDNA Eraser (TaKaRa, RR047A). The transcripts were then amplified by quantitative polymerase chain reaction (qPCR). The cDNA was used as a template and the reaction system was as follows: 5 ”L of 2Ă SYBR Green Mixture, 1 ”L of forward primer, 1 ”L of reverse primer, 2 ”L of RNaseâfree water, and 1 ”L of cDNA. The reaction conditions were a single cycle of preâdenaturation at 95°C for 1 min, followed by a total of 40 cycles at 95°C for 20 s and 60°C for 1 min. The primers are designed by Primer 3 software and synthesized by Sangon Biotech company. The amplification profile of PCR showed S curve and the level of mRNA was quantified using the 2âÎÎCt method. Table 1 presents the primer sequences.
| Gene | Amplicon size (bp) | Forward primer (5âČ â 3âČ) | Reverse primer (5âČ â 3âČ) |
|---|---|---|---|
| ÎČâactin | 120 | AGTGTGACGTTGACATCCGT | TGCTAGGAGCCAGAGCAGTA |
| Sirt1 | 116 | TAATGTGAGGAGTCAGCACC | GCCTGTTTGGACATTACCAC |
| Pgc1α | 114 | TGTGACTGGGGACTGTAGTA | AGAGCAGCACACTCTATGTC |
| NfÎșb | 119 | GCTCCTGTTCGAGTCTCCAT | TTGCGCTTCTCTTCAATCCG |
| Bdnf | 94 | TTACTCTCCTGGGTTCCTGA | ACGTCCACTTCTGTTTCCTT |
| Trkb | 104 | TCTGGAGGGTGCTATGCTAT | GGGGCAGAAACTCCAGAAAA |
| Psd95 | 72 | CCCAGGATATGTGAACGGAA | CCTGAGTTACCCCTTTCCAA |
| Syn | 124 | GCCTACCTTCTCCACCCTTT | GCACTACCAACGTCACAGAC |
Western blotting (WB)
The protocol of western blotting (WB) was performed as previously described (Wei et al., 2022). In brief, the hippocampal tissue was lysed in RIPA lysis buffer (Beyotime, P0013B) and centrifuged at 12,000 Ă g for 15 min to collect the supernatant. The protein samples were electrophoretically separated and then blotted onto polyvinylidene fluoride membranes (Millipore, IPVH00010). The protein levels were determined via incubation with antibodies against PGCâ1α (1:1000; abcam), SIRT1 (1:500; Santa Cruz), NFâÎșB (1:5000; abcam), brainâderived neurotrophic factor (BDNF; 1:1000; abcam), PSDâ95 (1:2000; abcam), SYN (1:1000; bioss), ILâ1ÎČ (1:500; bioss), ILâ6 (1:1000; Wanleibio), and TNFâα (1:1000; bioss). The membranes were then incubated with horseradish peroxidaseâlabeled secondary antibodies (1:20,000; Zsbio) according to the properties of the primary antibody. Protein detection was performed using an ECL luminescence kit (Thermo, 340958) and quantified with ImageJ software.
Enzymeâlinked immunosorbent assay (ELISA)
The concentrations of inflammatory factors (ILâ1ÎČ, ILâ6, and TNFâα) were detected in the hippocampal samples using corresponding enzymeâlinked immunosorbent assay (ELISA) kits from Wuhan ColorfulGene Biological Technology Co., Ltd. (JYM0531Mo, JYM0012Mo, and JYM0218Mo, respectively). All experiments were performed in accordance with the manufacturer's instructions.
Data analysis
All data are normal and expressed as mean ± standard errors of the mean. Repeatedâmeasures analysis of variance was used to analyze the data from the learning period of the Morris water maze test, whereas twoâway analysis of variance was used to analyze the data from the memory period of the Morris water maze test, novel object recognition, WB, RTâqPCR, and ELISA with the Tukey post hoc test to compare the differences among the four groups. The correlations between variables were determined using Pearson's correlation coefficient. All data analyses were performed using GraphPad 8.0 software. p < .05 was considered statistically different.
RESULTS
SSâ31 improved CSDâinduced recognition memory deficits
First, the novel object recognition test was used to evaluate whether SSâ31 could improve recognition memory deficits induced by CSD. During the familiarization phase, there was no significant difference in the exploration time for two same objects among the four groups (p > .05, Figure 2a,b). In the test phase, the NOI of SD + saline group was significantly lower than that in Control + saline group (treatment: F(1, 28) = 8.37, p < .01; drug: F(1, 28) = 4.71, p < .05; treatment Ă drug: F(1, 28) = 6.81, p < .05, Figure 2C). Furthermore, SSâ31 treatment reversed this decline in the SD + SSâ31 when compared to SD + saline group (p < .05). These results suggested that SSâ31 treatment could ameliorate the recognition memory impairment induced by CSD.

SSâ31 improved recognition memory in the novel object recognition test after sleep deprivation (SD) in mice: (a) Schematic of the novel object recognition test; (b) the percent time of each experimental group mice exploring two objects (object 1 and object 2) during familiarization phase; (c) the novel object recognition index of each experimental group during test phase. Twoâway ANOVA and Tukey's post hoc test,< .05 in comparison with the Control + saline group;< .05 in comparison with the SD + saline group. * $ p p
SSâ31 improved CSDâinduced spatial learning and memory impairment
The Morris water maze test was used to assess the influence of CSD and SSâ31 on hippocampalâdependent learning and memory. On the first day of the learning phase, there was no difference in the time of searching hidden platform in the four quadrants, indicating that the mice from four groups did not show a preference for any quadrant at the beginning of the learning phase (supplementary file Table 1). The escape latency and distance gradually decreased with an increase in the training days (escape latency: F(6,168) = 207.47, p < .01; distance: F(6,168) = 158.24, p < .01; Figure 3a,b). With respect to treatment effects, there were significant differences in escape latency and distance among the four groups (escape latency: F(3,28) = 10.10, p < .01; distance: F(3,28) = 8.93, p < .01; Figure 3A,B). The post hoc analysis documented that the mice from the SD + saline group spent a longer time to find the hidden platform than the mice from the Control + saline and Control + SSâ31 groups (Ps < .1). There was also a significant difference between the SD + saline and SD + SSâ31 groups (p < .01). No differences were observed in swimming velocity among the different treatment groups (Figure 3C).
In the memory phase, the number of platformâcrossing, percent time, and distance showed significant differences among the four groups (number of platformâcrossing: treatment: F(1, 28) = 9.93, p < .01; drug: F(1, 28) = 8.73, p < .01; treatment Ă drug: F(1, 28) = 6.55, p < .05; time: treatment: F(1, 28) = 19.12, p < .01; drug: F(1, 28) = 9.25, p < .01; treatment Ă drug: F(1, 28) = 4.97, p < .05; distance: treatment: F(1, 28) = 19.12, p < .01; drug: F(1, 28) = 12.28, p < .01; treatment Ă drug: F(1, 28) = 7.25, p < .05; Figure 3dâf, supplementary file Table 2). The post hoc analyses showed that the number of platformâcrossing, percent time, and distance were shorter in the SD + saline group than in the Control + saline group (p < .05). There was also a significant difference between the SD + saline and SD + SSâ31 groups (p < .05).

SSâ31 improved behavioral performance in the Morris water maze test after sleep deprivation (SD) in mice: (a and b) Each experimental group of mice learned to locate the hidden platform at the learning phase; (c) comparison of swimming velocity among the four groups; (d) the number of platformâcrossing in the memory phase of the Morris water maze test; (e and f) comparison of percent time and distance among the experimental groups during the memory phase. Twoâway ANOVA and Tukey's post hoc test,< .01 in comparison with the Control + saline group;< .05 in comparison with the SD + saline group,< .01 in comparison with the SD + saline group. ** $ $$ p p p
SSâ31 reverses the CSDâinduced changes to SIRT1, PGCâ1α, and NFâÎșB levels
The mRNA levels of Sirt1, Pgc1a, and Nfkb were different among the four groups (Sirt1: treatment: F(1, 28) = 46.93, p < .01; drug: F(1, 28) = 9.65, p < .01; treatment Ă drug: F(1, 28) = 10.48, p < .01; Pgc1a: treatment: F(1, 28) = 75.10, p < .01; drug: F(1, 28) = 12.83, p < .01; treatment Ă drug: F(1, 28) = 3.28, p > .05; Nfkb: treatment: F(1, 28) = 101.40, p < .01; drug: F(1, 28) = 30.18, p < .01; treatment Ă drug: F(1, 28) = 35.59, p < .01; Figure 4AâC, Figure S1). Post hoc analysis revealed that the mRNA expression of Sirt1 and Pgc1a was downregulated, whereas the expression of Nfkb mRNA was upregulated after CSD. Furthermore, SSâ31 treatment counteracted the effects induced by CSD.
Similarly, the protein levels of SIRT1, PGCâ1α, and NFâÎșB were different among the four groups (SIRT1: treatment: F(1, 20) = 74.25, p < .01; drug: F(1, 20) = 10.04, p < .01; treatment Ă drug: F(1, 20) = 11.13, p < .01; PGCâ1α: treatment: F(1, 20) = 144.20, p < .01; drug: F(1, 20) = 10.94, p < .01; treatment Ă drug: F(1, 20) = 7.95, p < .05; NFâÎșB: treatment: F(1, 20) = 34.91, p < .01; drug: F(1, 20) = 9.52, p < .01; treatment Ă drug: F(1, 20) = 19.86, p < .01; Figure 4dâg, Figure S1). Post hoc analysis showed that the protein levels of SIRT1 and PGCâ1α were decreased after CSD, which were restored with SSâ31 treatment. The protein level of NFâÎșB was increased in the SD + saline group when compared to that of the Control + saline group, and this effect was also reversed by SSâ31 treatment.

Effects of sleep deprivation (SD) and SSâ31 on the mRNA and protein levels of sirtuin 1 (SIRT1), peroxisome proliferatorâactivated receptor Îł coactivator alpha (PGCâ1α), and nuclear factor kappaâB (NFâÎșB): (aâc) Quantification of mRNA levels among the four groups; (d) representative SIRT1, PGCâ1α, and NFâÎșB immunoreactive bands in the hippocampus of each experimental group: band 1, Control + saline; band 2, Control + SSâ31; band 3, SD + saline; band 4, SD + SSâ31; (eâg) quantification of protein levels among the four groups. Twoâway ANOVA and Tukey's post hoc test,< .05 in comparison with the Control + saline group,< .01 in comparison with the Control + saline group;< .05 in comparison with the SD + saline group,< .01 in comparison with the SD + saline group. * ** $ $$ p p p p
SSâ31 suppresses the CSDâinduced increase in proinflammatory cytokines
The expression levels of ILâ1ÎČ, ILâ6, and TNFâα were significantly different among the four groups (ELISA: ILâ1ÎČ: treatment: F(1, 28) = 26.30, p < .01; drug: F(1, 28) = 16.17, p < .01; treatment Ă drug: F(1, 28) = 8.25, p < .01; ILâ6: treatment: F(1, 28) = 19.71, p < .01; drug: F(1, 28) = 9.09, p < .01; treatment Ă drug: F(1, 28) = 6.49, p < .05; TNFâα: F(1, 28) = 21.26, p < .01; drug: F(1, 28) = 13.15, p < .01; treatment Ă drug: F(1, 28) = 1.82, p > .05; Figure 5aâc; WB: ILâ1ÎČ: treatment: F(1, 20) = 21.88, p < .01; drug: F(1, 20) = 14.80, p < .01; treatment Ă drug: F(1, 20) = 11.78, p < .01; ILâ6: treatment: F(1, 20) = 20.54, p < .01; drug: F(1, 20) = 8.40, p < .01; treatment Ă drug: F(1, 20) = 8.40, p < .01; TNFâα: F(1, 20) = 29.58, p < .01; drug: F(1, 20) = 21.33, p < .01; treatment Ă drug: F(1, 28) = 13.78, p < .01; Figure 5dâg, Figure S2). Post hoc analyses showed upregulation expression of ILâ1ÎČ, ILâ6, and TNFâα in the SD + saline group when compared to the Control + saline group; however, SSâ31 immediately improved the increase in the levels of ILâ1ÎČ, ILâ6, and TNFâα.

Effects of sleep deprivation (SD) and SSâ31 on the expression levels of the proinflammatory cytokines: (aâc) Quantification of interleukin (IL)â1ÎČ, ILâ6, and tumor necrosis factorâalpha (TNFâα) levels by enzymeâlinked immunosorbent assay; (d) representative ILâ1ÎČ, ILâ6, and TNFâα immunoreactive bands in the hippocampus of each experimental group: band 1, Control + saline; band 2, Control + SSâ31; band 3, SD + saline; band 4, SD + SSâ31; (eâg) quantification of ILâ1ÎČ, ILâ6, and TNFâα levels by western blotting. Twoâway ANOVA and Tukey's post hoc test,< .01 in comparison with the Control + saline group;< .05 in comparison with the SD + saline group,< .01 in comparison with the SD + saline group. ** $ $$ p p p
SSâ31 restores the CSDâinduced changes in synaptic plasticityâassociated proteins
The mRNA levels of Bdnf, Psd95, and Syn were significantly different among the four groups (Bdnf: treatment: F(1, 28) = 68.71, p < .01; drug: F(1, 28) = 9.75, p < .01; treatment Ă drug: F(1, 28) = 2.17, p > .05; Psd95: treatment: F(1, 28) = 62.22, p < .01; drug: F(1, 28) = 2.66, p < .01; treatment Ă drug: F(1, 28) = 9.91, p < .01; Syn: treatment: F(1, 28) = 45.42, p < .01; drug: F(1, 28) = 1.28, p > .05; treatment Ă drug: F(1, 28) = 9.48, p < .01; Figure 6aâc). The post hoc analyses revealed that the mRNA levels of all three of these synaptic plasticityâassociated factors were decreased in the SD + saline group compared with those of the Control + saline and Control + SSâ31 groups (Ps < .01). SSâ31 treatment attenuated the decrease of Bdnf, Psdâ95, and Syn mRNA levels in the SD + SSâ31 group (Ps < .05).
The protein expression level of BDNF was also significantly different among the four groups (treatment: F(1, 20) = 104.40, p < .01; drug: F(1, 20) = 3.07, p > .05; treatment Ă drug: F(1, 20) = 5.85, p < .05; Figure 6d,e; Figure S3). Post hoc analysis showed that the expression level of BDNF was decreased in the SD + saline group compared with that in the Control + saline group (p < .01), whereas SSâ31 treatment restored the BDNF protein content (p < .01). The protein expression levels of PSDâ95 and SYN were different among the four groups (PSDâ95: treatment: F(1, 20) = 59.09, p < .01; drug: F(1, 20) = 3.61, p > .05; treatment Ă drug: F(1, 20) = 7.39, p < .05; SYN: treatment: F(1, 20) = 106.90, p < .01; drug: F(1, 20) = 3.50, p > .05; treatment Ă drug: F(1, 20) = 6.73, p < .05; Figure 6f,g; Figure S3). The post hoc analysis showed that the protein expression of PSDâ95 and SYN was downregulated in the SD + saline group compared to that of the Control + saline group (Ps < .01), whereas SSâ31 significantly attenuated the decrease of PSDâ95 and SYN protein levels in the Control + SSâ31 group (Ps < .05).

Effects of sleep deprivation (SD) and SSâ31 on the mRNA and protein levels of synaptic plasticityâassociated proteins: (aâc) Quantification of the mRNA levels of brainâderived neurotrophic factor (BDNF), postsynaptic densityâ95 (PSDâ95), and synaptophysin (SYN) among the four groups; (d) representative BDNF, PSDâ95, and SYN immunoreactive bands in the hippocampus of each experimental group: band 1, Control + saline; band 2, Control + SSâ31; band 3, SD + saline; band 4, SD + SSâ31; (eâg) quantification of the protein levels of BDNF, PSDâ95, and SYN among the four groups. Twoâway ANOVA and Tukey's post hoc test,< .05 in comparison with the Control + saline group,< .01 in comparison with the Control + saline group;< .05 in comparison with the SD + saline group,< .01 in comparison with SD + saline group. * ** $ $$ p p p p
Morris water maze performance indices are correlated with markers of mitochondrial biogenesis, inflammation, and synaptic function
The escape latency and distance were negatively correlated with the levels of SIRT1, PGCâ1α, BDNF, PSDâ95, SYN, and were positively correlated with the levels of NFâÎșB and proâinflammatory cytokines including ILâ1ÎČ, ILâ6, and TNFâα in the learning phase. In the memory phase, the percent time and distance were positively correlated with the levels of SIRT1, PGCâ1α, BDNF, PSDâ95, and SYN and were negatively correlated with the levels of NFâÎșB and proâinflammatory cytokines, as shown in Tables 2, 3, 4.
| Tasks | Indexes | Groups | Proinflammatory cytokines | ||
|---|---|---|---|---|---|
| ILâ1ÎČ | ILâ6 | TNFâα | |||
| Morris water maze test | Escape latency | Control + saline | 0.801 (0.017)* | â0.190 (0.653)** | 0.041 (0.924) |
| Control + SSâ31 | 0.776 (0.024)* | 0.752 (0.031)* | 0.898 (0.002)** | ||
| SDÂ +Â saline SDÂ +Â SSâ31 | 0.791 (0.020)* 0.853 (0.007)** | 0.690 (0.058) 0.842 (0.009)** | 0.822 (0.012)* 0.799 (0.017)* | ||
| Distance | Control + saline Control + SSâ31 | 0.834 (0.010)* 0.823 (0.012)* | â0.102 (0.810) 0.769 (0.026)* | 0.243 (0.562) 0.802 (0.017)* | |
| SDÂ +Â saline | 0.866 (0.005)** | 0.807 (0.015)* | 0.885 (0.003)** | ||
| SDÂ +Â SSâ31 | 0.709 (0.049)* | 0.763 (0.028)* | 0.783 (0.022)* | ||
| Percentage of distance swam | Control + saline | â0.843 (0.009)** | â0.117 (0.783) | â0.139 (0.743) | |
| Control + SSâ31 | â0.868 (0.005)** | â0.893 (0.003)** | â0.796 (0.018)* | ||
| SDÂ +Â saline SDÂ +Â SSâ31 | â0.825 (0.012)* â0.833 (0.010)* | â0.761 (0.028)* â0.726 (0.041)* | â0.858 (0.006)** â0.759 (0.029)* | ||
| Percentage of time swam | Control + saline | â0.843 (0.009)** | â0.117 (0.783) | â0.139 (0.743) | |
| Control + SSâ31 | â0.868 (0.005)** | â0.893 (0.003)** | â0.796 (0.018)* | ||
| SDÂ +Â saline SDÂ +Â SSâ31 | â0.825 (0.012)* â0.833 (0.010)* | â0.761 (0.028)* â0.726 (0.041)* | â0.858 (0.006)** â0.759 (0.029)* | ||
| Tasks | Indexes | Groups | mRNA levels | |||||
|---|---|---|---|---|---|---|---|---|
| NFâÎșb | Sirt1 | Pgc1α | Bdnf | Psdâ95 | Syn | |||
| Morris water maze test | Escape latency | Control +  saline | 0.540 (0.167) | â0.365 (0.375) | â0.716 (0.046)* | â0.668 (0.070) | â0.753 (0.031)* | â0.756 (0.030)* |
| Control + SSâ31 | 0.746 (0.033)* | â0.709 (0.049)* | â0.833 (0.010)* | â0.706 (0.050) | â0.921 (0.001)** | â0.734 (0.038)* | ||
| SDÂ +Â saline SDÂ +Â SSâ31 | 0.896 (0.003)** 0.903 (0.002)** | â0.869 (0.005)** â0.973 (0.000)** | â0.886 (0.003)** â0.842 (0.009)** | â0.839 (0.009)** â0.788 (0.020)* | â0.930 (0.001)** â0.940 (0.001)** | â0.884 (0.004)** â0.870 (0.005)** | ||
| Distance | Control + saline Control + SSâ31 | 0.458 (0.254) 0.754 (0.031)* | â0.663 (0.073) â0.716 (0.046)* | â0.754 (0.031)* â0.830 (0.011)* | â0.580 (0.132) â0.712 (0.048)* | â0.705 (0.051) â0.896 (0.003)** | â0.732 (0.039)* â0.759 (0.029)* | |
| SDÂ +Â saline | 0.862 (0.006)** | â0.872 (0.005)** | â0.799 (0.017)* | â0.815 (0.014)* | â0.911 (0.002)** | â0.881 (0.004)** | ||
| SDÂ +Â SSâ31 | 0.885 (0.003)** | â0.966 (0.000)** | â0.822 (0.012)* | â0.764 (0.027)* | â0.951 (0.000)** | â0.826 (0.011)* | ||
| Percentage of distance swam | Control + saline | â0.808 (0.015)* | 0.595 (0.120) | 0.847 (0.008)** | 0.610 (0.108) | 0.604 (0.113) | 0.840 (0.009)** | |
| Control + SSâ31 | â0.758 (0.029)* | 0.718 (0.045)* | 0.761 (0.028)* | 0.839 (0.009)** | 0.884 (0.004)** | 0.771 (0.025)* | ||
| SDÂ +Â saline SDÂ +Â SSâ31 | â0.890 (0.003)** â0.871 (0.005)** | 0.723 (0.043)* 0.883 (0.004)** | 0.952 (0.000)** 0.818 (0.013)* | 0.807 (0.016)* 0.778 (0.023)* | 0.890 (0.003)** 0.835 (0.010)** | 0.879 (0.004)** 0.812 (0.014)* | ||
| Percentage of time swam | Control + saline | â0.808 (0.015)* | 0.595 (0.120) | 0.847 (0.008) | 0.610 (0.108) | 0.604 (0.113) | 0.840 (0.009)** | |
| Control + SSâ31 | â0.758 (0.029)* | 0.718 (0.045)* | 0.761 (0.028)* | 0.839 (0.009)** | 0.884 (0.004)** | 0.771 (0.025)* | ||
| SDÂ +Â saline SDÂ +Â SSâ31 | â0.890 (0.003)** â0.871 (0.005)** | 0.723 (0.043)* 0.883 (0.004)** | 0.952 (0.000)** 0.818 (0.013)* | 0.807 (0.016)* 0.778 (0.023)* | 0.890 (0.003)** 0.835 (0.010)** | 0.879 (0.004)** 0.812 (0.014)* | ||
| Tasks | Indexes | Groups | Proteins levels | |||||
|---|---|---|---|---|---|---|---|---|
| NFâÎșB | Sirt1 | PGCâ1α | BDNF | PSDâ95 | SYN | |||
| Morris water maze test | Escape latency | Control + saline | 0.820 (0.046)* | â0.770 (0.073) | â0.658 (0.155) | â0.763 (0.078) | â0.718 (0.108) | â0.746 (0.088) |
| Control + SSâ31 | 0.939 (0.005)** | â0.927 (0.008)** | â0.852 (0.031)* | â0.898 (0.015)* | â0.836 (0.038)* | â0.904 (0.013)* | ||
| SDÂ +Â saline SDÂ +Â SSâ31 | 0.959 (0.002)** 0.853 (0.031)* | â0.894 (0.016)* â0.906 (0.013) | â0.888 (0.018)* â0.847 (0.033)* | â0.994 (0.000)** â0.880 (0.021)* | â0.973 (0.001)** â0.913 (0.011)* | â0.988 (0.000)** â0.958 (0.003)** | ||
| Distance | Control + saline Control + SSâ31 | 0.394 (0.440) 0.835 (0.039)* | â0.533 (0.276) â0.888 (0.018)* | â0.323 (0.533) â0.907 (0.013)* | â0.358 (0.486) â0.968 (0.002)** | â0.243 (0.643) â0.833 (0.040)* | â0.369 (0.472) â0.977 (0.001)** | |
| SDÂ +Â saline | 0.860 (0.028)* | â0.873 (0.023)* | â0.699 (0.122) | â0.936 (0.006)** | â0.855 (0.030)* | â0.902 (0.014)* | ||
| SDÂ +Â SSâ31 | 0.944 (0.005)** | â0.866 (0.026)* | â0.919 (0.009)** | â0.915 (0.011)* | â0.864 (0.026)* | â0.823 (0.044)* | ||
| Percentage of distance swam | Control + saline | â0.811 (0.050) | 0.619 (0.190) | 0.453 (0.367) | 0.469 (0.349) | 0.725 (0.103) | 0.559 (0.249) | |
| Control + SSâ31 | â0.899 (0.015)* | 0.929 (0.007)** | 0.856 (0.030)* | 0.869 (0.025)* | 0.830 (0.041)* | 0.852 (0.031)* | ||
| SDÂ +Â saline SDÂ +Â SSâ31 | â0.967 (0.002)** â0.966 (0.002)** | 0.922 (0.009)** 0.997 (0.000)** | 0.971 (0.001)** 0.894 (0.016)* | 0.866 (0.026)* 0.986 (0.000)** | 0.949 (0.004)** 0.952 (0.003)** | 0.910 (0.012)* 0.974 (0.001)** | ||
| Percentage of time swam | Control + saline | â0.811 (0.050) | 0.619 (0.190) | 0.453 (0.367) | 0.469 (0.349) | 0.725 (0.103) | 0.559 (0.249) | |
| Control + SSâ31 | â0.899 (0.015)* | 0.929 (0.007)** | 0.856 (0.030)* | 0.869 (0.025)* | 0.830 (0.041)* | 0.852 (0.031)* | ||
| SDÂ +Â saline SDÂ +Â SSâ31 | â0.967 (0.002)** â0.966 (0.002)** | 0.922 (0.009)** 0.997 (0.000)** | 0.971 (0.001)** 0.894 (0.016)* | 0.866 (0.026)* 0.986 (0.000)** | 0.949 (0.004)** 0.952 (0.003)** | 0.910 (0.012)* 0.974 (0.001)** | ||
DISCUSSION
In the present study, we observed that CSDâinduced alterations in learning and memory function, mitochondrial function, SIRT1 expression, the inflammatory response, and synaptic function could be restored by SSâ31 treatment. Therefore, SSâ31 could be a potential agent in the treatment of cognitive impairment induced by CSD.
SSâ31 improves learning and memory impairment induced by CSD
We assessed cognitive impairment using the novel object recognition and Morris water maze tests in this study, as this is proven to be reliable tests that are strongly related with hippocampalâdependent learning and memory (Zhang, Chen, et al., 2022). Previous studies showed that sleep dysfunction could affect hormone levels, neural circuits, dendrite density, and synaptic transmission, leading to cognitive decline (BrĂŒning et al., 2019; Voldsbekk et al., 2022). Male Wistar rats subjected to sleep deprivation for 3 days showed spatial memory decline during the Morris water maze test (Duan et al., 2016). Shortâterm sleep deprivation of 6 h significantly impaired the memory consolidation in male C57BL/6J mice during the objectâlocation memory paradigm (Raven et al., 2020). Consistently, we found that CSD for 21 days decreased the NOI during the NOI, increased escape latency and distance, and increased time and distance percent in the SD + SSâ31 group compared to the SD + saline group during the Morris water maze, indicating impaired learning and memory in CSD mice.
The cognitive protective effects of SSâ31 have been extensively studied in various pathological models. One study showed that SSâ31 pretreatment improved isofluraneâinduced cognitive decline through improving mitochondrial function (Wu, Li, et al., 2015). Another study showed that SSâ31 increased the downregulation in the percentage freezing time caused by sepsisâassociated encephalopathy during contextual fear conditioning (Wu, Zhang, et al., 2015). We found that treatment with SSâ31 improved CSDâinduced learning and memory impairment as observed in the novel object recognition and Morris water maze tests. Additionally, the mice from the Control + SSâ31 group showed no significant difference from those in the Control + saline group in the novel object recognition and Morris water maze tests. This suggests that SSâ31 might only have an effect on damaged mitochondria and not on normal mitochondria.
SSâ31 improves mitochondrial dysfunction induced by CSD
Accumulating evidence suggests that integrated mitochondrial function is closely related to cognitive function (Zhuang et al., 2021). The structure and number of mitochondria are not static, as mitochondria grow and divide continuously in a process known as mitochondrial biogenesis to respond to changing energy demands and stressful events. PGCâ1α is an important transcription factor involved in mitochondrial biogenesis, which helps to maintain mitochondrial function by regulating mitochondrial dynamics and energy (Chen et al., 2011; Zhu et al., 2010). PGCâ1α is transferred to the nucleus where it coâactivates nuclear respiratory factor (NRF) and mitochondrial transcription factor A (TFAM). The combination of NRF and TFAM then promotes the replication and expression of mitochondrial genes (Finck & Kelly, 2006; Scarpulla, 2008). Furthermore, SIRT1 is a pivotal factor in the regulation of mitochondrial metabolism, which activates PGCâ1α through histone deacetylation. Isofluraneâinduced anesthesia decreased the expression of SIRT1 and PGCâ1α and impaired cognitive function in aging rats (Yang et al., 2020). Triptolide activated the SIRT1/PGCâ1α signaling pathway to improve cognitive impairment in rats with vascular dementia (Yao et al., 2019). In the current study, we found that the mRNA and protein levels of SIRT1 and PGCâ1α were decreased in the SD + saline group after CSD, implying that mitochondrial biogenesis dysfunction was involved in the cognitive impairment induced by CSD. Moreover, SSâ31 increased the levels of SIRT1 and PGCâ1α under the sleep deprivation condition, suggesting that SSâ31 improves CSDâinduced cognitive and mitochondrial dysfunction by modulating the SIRT1/PGCâ1α signaling pathway.
SSâ31 improves inflammatory response induced by CSD
Progressive neuroinflammation plays a primary role in the cognitive impairment related with neurodegenerative diseases such as Alzheimer's disease and Huntington's disease (Bains et al., 2022; Decandia et al., 2023). Neuroinflammation influences cell proliferation and differentiation, synaptic plasticity, and cognitive function (Bai et al., 2023; Cangalaya et al., 2023). The levels of proâinflammatory cytokines were found to be increased in the peripheral blood of patients with sleep disorders (Irwin et al., 2016; Xia et al., 2021). In addition, sleep deprivation significantly elevated the levels of proinflammatory cytokines including ILâ1ÎČ, ILâ6, and TNFâα in the hippocampus and resulted in cognitive impairment during the novel object recognition test (Lu et al., 2022). In line with these previous studies, the results showed that the levels of ILâ1ÎČ, ILâ6, and TNFâα were increased in the hippocampus of the mice exposed to CSD, which contributed to the observed cognitive decline.
Growing evidence suggests that mitochondria are directly linked to the immune system and inflammatory response. NFâÎșB and NODâlike receptor thermal protein domain associated protein 3 (NLPR3) are important transcription factors associated with the inflammatory response. The ROS produced by mitochondria activate NFâÎșB and NLPR3, which in turn promotes the excessive release of the proâinflammatory cytokines (Nakahira et al., 2011; Sato et al., 2004; Zhou et al., 2011). Importantly, a previous study showed that treatment with SSâ31 significantly ameliorated isofluraneâinduced cognitive deficits and inflammatory responses by decreasing the levels of NFâÎșB, NLPR3, and ROS (Wu et al., 2015). Our results showed that SSâ31 reduced the elevated levels of NFâÎșB and proinflammatory cytokines in the SD + SSâ31 group, suggesting that SSâ31 could suppress the CSDâinduced inflammatory response by improving mitochondrial dysfunction.
SSâ31 improves synaptic dysfunction induced by chronic sleep deprivation
BDNF is mainly expressed in the hippocampus, where it controls neuronal maturation and survival (MosioĆek et al., 2022). A large body of evidence suggests that BDNF plays an important role in synaptic plasticity and synaptic transmission that is considered to underlie learning and memory (Liu et al., 2022; Wang et al., 2023). SYN and PSDâ95 are synaptic proteins that are closely related to synaptic maturation, transmission, and remodeling (Aguiar et al., 2022; ReinĂ©s et al., 2008). Decreased expression levels of BDNF, SYN, and PSDâ95 have been associated with the pathogenesis of cognitive dysfunction (Wang & Zhao, 2016; Hong et al., 2020). The present study showed that CSD decreased the mRNA and protein levels of BDNF, SYN, and PSDâ95 in mice, which contributed to cognitive deficits induced by CSD. Furthermore, pretreatment with SSâ31 attenuated the reduction of BDNF, SYN, and PSDâ95 induced by CSD, which is consistent with a previous study showing that SSâ31 prevented the lipopolysaccharideâinduced downregulated of SYN and PSDâ95 through modulating the BDNF signaling pathway (Zhao et al., 2019).
Correlation between the cognitionârelated performance and the markers of mitochondrial biogenesis, proinflammatory response, and synaptic function
Emerging evidence also suggests that mitochondrial biogenesis function is closely related to cognitive function. Our previous study showed that the decreased expression level of PGCâ1α was correlated with poor cognitive performance induced by prenatal inflammatory exposure during the Morris water maze test (Zhuang et al., 2021). In the current study, the downregulated expression of PGCâ1α was also considered to play a role in the learning and memory impairment induced by CSD, as reflected by the correlation between the expression level of PGCâ1α and indicators of the Morris water maze test in the SD + SD group. Clinical studies have found that the levels of antiâinflammatory cytokines are positively correlated with cognitive performance associated with sleep disorders (He et al., 2021). Thus, our preclinical study confirms that the levels of proâinflammatory cytokines are correlated with the cognitive impairment induced by CSD. Additionally, the levels of synaptic plasticityâassociated proteins reflect the function of synaptic connection, synaptic transmission, and synaptic plasticity and are closely associated with cognitive function (SadighâEteghad et al., 2020). We also found that the decreased expression levels of BDNF, SYN, and PSDâ95 were correlated with CSDâinduced cognitive impairment.
Our study has some limitations. First, we have not further evaluated mitochondrial function and oxidative stress in the hippocampus, including the mitochondrial electron transport system, ROS, and antioxidant defense enzymes. Second, we determined the mitochondrial biogenesis in the whole hippocampus; thus, it was not possible to distinguish whether mitochondrial dysfunction in the neurons or glial cells was responsible for the inflammation and synaptic dysfunction induced by CSD. Third, we only selected male mice for behavioral experiment and did not evaluate the sex effects of CSD on cognitive function even though previous studies have reported that women are more susceptible to develop sleep disorders than men. Finally, the markers of mitochondrial function, inflammation, and synaptic function were only examined in the hippocampus and were not examined in other regions associated with cognitive function.
CONCLUSION
In conclusion, our results demonstrated that inflammation and synaptic dysfunction induced by mitochondrial biogenesis dysfunction are involved in the cognitive impairment caused by CSD. The mitochondrialâtargeted antioxidant SSâ31 could improve the CSDâinduced inflammation response, synaptic dysfunction, and cognitive deficits by attenuating mitochondrial biogenesis dysfunction. This work suggests that SSâ31 could be a novel agent for patients with chronic insomniaâassociated cognitive impairment. Future studies are needed to explore the protective effects of SSâ31 on mitochondrial dysfunction and cognitive deficits in more pathological models.
AUTHOR CONTRIBUTIONS
YueâMing Zhang: Conceptualization; investigation; methodology; software; supervision; writingâoriginal draft. YaâTao Wang: Conceptualization; investigation; validation; methodology; software; formal analysis; writingâoriginal draft. RuâMeng Wei: Conceptualization; investigation; validation; visualization; formal analysis; supervision; writingâoriginal draft. XueâYan Li: Data curation; supervision; formal analysis; validation; funding acquisition; conceptualization; investigation. BaoâLing Luo: Conceptualization; investigation; funding acquisition; visualization; validation; software; supervision; resources. JingâYa Zhang: Conceptualization; writingâoriginal draft; funding acquisition; validation; methodology; software; supervision; data curation. KaiâXuan Zhang: Conceptualization; investigation; validation; methodology; formal analysis; software; supervision; resources. ShiâKun Fang: Conceptualization; investigation; writingâoriginal draft; validation; methodology; software; formal analysis; supervision; data curation. XueâChun Liu: Conceptualization; funding acquisition; validation; methodology; software; formal analysis; data curation; supervision; writingâreview and editing. GuiâHai Chen: Conceptualization; investigation; funding acquisition; methodology; validation; visualization; software; supervision; data curation; resources; writingâreview and editing.
CONFLICT OF INTEREST STATEMENT
The authors report no conflicts of interest in this work.
PEER REVIEW
The peer review history for this article is available at https://publons.com/publon/10.1002/brb3.3508â.