What this is
- This research investigates the role of () in the reproductive development of male oriental river prawns (Macrobrachium nipponense).
- Using () and quantitative PCR (qPCR), the study examines how affects testis development and hormone expression.
- The findings suggest that positively regulates testis development by influencing the expression of insulin-like androgenic gland hormone.
Essence
- () regulates testis development in male oriental river prawns (Macrobrachium nipponense) by affecting hormone expression. () targeting significantly reduced sperm cell presence.
Key takeaways
- expression was significantly higher in the testis and ovary compared to other tissues, with levels 505.56× and 840.39× higher than the female eyestalk, respectively. This indicates its crucial role in reproductive development.
- targeting led to a 94.8% decrease in hormone expression at day 7 and 88.9% at day 14 post-injection. This highlights 's regulatory influence on hormone levels critical for testis development.
- Histological observations revealed that only about 5% of cells were sperm in -injected prawns by day 14, compared to over 80% in controls. This demonstrates the significant impact of on sperm cell development.
Caveats
- The study primarily focuses on a single species, limiting the generalizability of the findings to other crustaceans. Further research is needed to confirm these results across different species.
- The method used may have off-target effects, which could influence the results. Validation of specific gene knockdown is crucial for accurate interpretation.
Definitions
- RNA interference (RNAi): A biological process where RNA molecules inhibit gene expression or translation, effectively silencing targeted genes.
- polo-like kinase 1 (Plk1): A serine/threonine kinase involved in cell cycle regulation, particularly in processes like centrosome maturation and mitosis.
AI simplified
Introduction
The X-organ–SG complex (XO–SG) is a principal neuroendocrine gland in crustaceans, and it is located in the eyestalk. It stores and releases many neurosecretory hormones (1) that play essential roles in the regulation of many biological functions in crustacean species (2–12). The neurosecretory hormones secreted by the XO–SG have been reported to have negatively regulatory effects on both testis and ovarian development of the oriental river prawn (Macrobrachium nipponense) (13–15). For example, Qiao et al. (2015) showed that knockdown of the expression of the gonad-inhibiting hormone gene from female M. nipponense promoted ovarian development, as verified by RNA interference (RNAi) (13). Testis development was induced by stimulating the expression of the insulin-like androgenic gland hormone (IAG) gene in M. nipponense when eyestalks were ablated in male prawns (14, 15). IAG is a well-studied gene among crustacean species. It promotes male sex differentiation and the establishment of the male sex characteristics, especially testis development (16, 17). In Macrobrachium rosenbergii, decreased IAG expression caused by RNAi inhibited male sex differentiation and development of secondary sexual characteristics, especially spermatogenesis (18). Similar functions of IAG are well known in many other crustacean species (19–23).
Researchers have conducted transcriptome profiling analysis of the androgenic gland after the ablation of eyestalks from male M. nipponense in order to identify metabolic pathways and genes that are involved in the reproductive development of male M. nipponense (14). They proposed that the cell cycle plays essential roles in the regulation of male reproductive development in M. nipponense because it was the main metabolic pathway enriched in differentially expressed genes (14). The cell cycle ensures correct cell proliferation and plays crucial regulatory roles in the prevention and/or correction of damaged DNA, mutations, and genetic abnormalities (24, 25). Thus, the up-regulated and enriched genes in the metabolic pathway of the cell cycle were predicted to regulate the process of reproductive development in male M. nipponense based on the negative relationship between the neurosecretory hormones secreted by the XO–SG and reproductive development of male prawns.
Previously, polo-like kinase 1 (Plk1) was found to be enriched in the metabolic pathway of the cell cycle, and its expression was significantly up-regulated in the androgenic gland after eyestalk ablation in male M. nipponense (14). This finding suggested that Plk1 may promote the reproductive development of male M. nipponense. The cell cycle process is regulated by a variety of kinases, including those in the Plk family. Plk1 was the first and continues to be the most studied Plk, and it is involved in regulation of the cell cycle. It can promote the maturation of centrosomes during the G2/M transition and the separation of centrosomes, and it can regulate the activation of cyclin-dependent kinase 1 and spindle assembly (26, 27). Plk1 proteins are reported to be expressed during the late G2/M phase, regulating the process of mitosis in all animal species (28). Previous studies have shown that Plk1 plays essential roles in therapies designed to treat a variety of cancers, including primary colorectal cancer (29), prostate and pancreatic cancers (30), and rectal cancer (31). However, studies of the effects of Plk1 on gonad development are rare. Knockdown of the expression of Plk1 was shown to inhibit female meiosis in the fruit fly Drosophila melanogaster, indicating that Plk1 is involved in the process of oogenesis (32). Additionally, the Plk1 of the blood fluke Schistosoma mansoni was reported to be a key mitotic kinase that is involved in the process of parasite reproduction (33).
M. nipponense is widely distributed in freshwater and low-salinity estuarine regions in China and other Asian countries. It is a commercially important species in China, providing huge economic benefits (34). The rapid gonad development of hatchlings has restricted the sustainable development of the M. nipponense industry, as newly hatched male and female M. nipponense can reach sexual maturity within 40 days after hatching during the reproductive season (35). Rapid gonad development affects the market size of M. nipponense because it has negative regulatory effects on growth performance (36, 37). Thus, an artificial technique to regulate the process of gonad development in this species is urgently needed.
The goal of this study was to investigate the potential functions of Plk1 in male reproductive development of M. nipponense using quantitative real-time PCR (qPCR), RNAi, and histological observations. Our results can be applied to development of an artificial technique to regulate the process of gonad development in M. nipponense. They also provide a basis for further studies of the mechanism of male reproductive development in other crustacean species.
Methods and materials
Ethics approval
Permission to conduct the experiments was obtained from the the Freshwater Fisheries Research Center (2021JBFM02, 12-06-2021). All experiments were performed in accordance with Jiangsu Laboratory’s Animal Management Guidelines (014000319/2008-00079). All M. nipponense used in this study were collected from the Dapu M. nipponense Breeding Base (120°13′44″E, 31°28′ 22″N; Wuxi, China). All prawns were maintained for 3 days in aerated freshwater with dissolved oxygen content ≥ 6 mg/L prior to tissue collection. An ice bath was used to anesthetize the prawns when tissues were collected (38).
Tissue collection
Testis were collected for the synthesis of templates and used for rapid amplification of cDNA ends (RACE) cloning. Different tissues collected for qPCR analysis included eyestalks, brain, heart, hepatopancreas, muscle, gonad, and gills from both male (body weight of 2.87-4.12 g) and female (body weight of 1.84-2.12 g) M. nipponense. Specimens at different developmental stages were collected from a full-sib population every 5 days during their maturation process. The body weights of the full-sib population were from 0.003-0.021 g. Testis and androgenic gland were sampled during both the reproductive season in July (water temperature of 30 ± 2°C, illumination time ≥ 16 h) (body weight of 3.12-4.47 g) and the non-reproductive season in January (water temperature of 13 ± 2°C, illumination time ≤ 12 h) (body weight of 2.15-3.97 g). For each tissue, sex, and time point, five samples were pooled together to form a biological replicate, and three biological replicates were used for qPCR analysis. All collected tissues were immediately preserved in liquid nitrogen until used for qPCR analysis.
RACE
Table 1 lists the specific primers used for Mn-Plk1 cloning. The primers were designed using the Primer-BLAST tool from NCBI (http://www.ncbi.nlm.nih.gov/tools/primer-blast/↗) based on the open reading frame (ORF) of Mn-Plk1. The full-length cDNA of Mn-Plk1 was cloned using the RACE technique following the methods described in previous studies (39, 40). Briefly, the total RNA from the testis was extracted using RNAiso Plus Reagent (Takara, Shiga, Japan), and the extracted total RNA was then used to synthesize the templates for 3′cDNA and 5′cDNA cloning using the 3′-Full RACE Core Set Ver.2.0 kit and the 5′-Full RACE kit (Takara), respectively. After the assembling, two pairs of primer were designed based on the full-length cDNA sequence of Mn-Plk1, in order to verify the accuracy of Mn-Plk1 cDNA sequence (Table 1).
| Primer name | Nucleotide Sequence(5′→3′) | Purpose |
|---|---|---|
| PLK-3GSP1 | CACTATCACCAGCTGAAGAAT | FWD first primer for PLK 3′ RACE |
| PLK -3GSP2 | AACTCTTAAGCTCTCAAGCAT | FWD second primer for PLK 3′ RACE |
| PLK -5GSP1 | CTTTTTACATAATATTTCTGGG | RVS first primer for PLK 5′ RACE |
| PLK -5GSP2 | AACCCATGAAAGCCGACAACAT | RVS second primer for PLK 5′ RACE |
| 3′RACE OUT | TACCGTCGTTCCACTAGTGATTT | RVS first primer for 3′ RACE |
| 3′RACE IN | CGCGGATCCTCCACTAGTGATTTCACTATAGG | RVS second primer for 3′ RACE |
| 5′RACE OUT | CATGGCTACATGCTGACAGCCTA | FWD first primer for 5′ RACE |
| 5′RACE IN | CGCGGATCCACAGCCTACTGATGATCAGTCGATG | FWD second primer for 5′ RACE |
| PLK-F1 | GTTATTTTTCGGCTGTTTTGGG | Primers for cDNA sequence verification |
| PLK-R1 | GAATGTTGTCTCCATCGGCAAG | |
| PLK-F2 | TCAATGAAGATGAGTGTGAGGA | |
| PLK-R2 | AGTTATGTCTACATAAGACTAC | |
| PLK RNAi-F | TAATACGACTCACTATAGGGCCATCTGAACAGCAAGCAAA | FWD primer for RNAi analysis |
| PLK RNAi-R | TAATACGACTCACTATAGGGACACCAATGGAGTCGTCACA | RVS primer for RNAi analysis |
Structural analysis of Mn-Plk1
The structural characteristics of Mn- Plk1 were analysed using the BLASTx and BLASTN search program (http://www.ncbi.nlm.nih.gov/BLAST/↗) and the ORF Finder tool (http://www.ncbi.nlm.nih.gov/gorf/gorf.html↗). The theoretical isoelectric point and the molecular weight of Mn-Plk1 protein were measured using the ComputepI/Mwtool software (http://ca.expasy.org/tools/pi_tool.html↗). Table 2 lists the accession numbers of amino acid sequences of different species, which were used to construct the phylogenetic tree of Plk1 using MEGA X, the maximum-likelihood method, and the bootstrap method with 1000 replications.
| Species | Accession number |
|---|---|
| Macrobrachium nipponense | |
| Procambarus clarkii | XP_045623220.1 |
| Penaeus monodon | XP_037785985.1 |
| Penaeus japonicus | XP_042864001.1 |
| Penaeus vannamei | XP_027211725.1 |
| Portunus trituberculatus | XP_045137394.1 |
| Pollicipes pollicipes | XP_037092997.1 |
| Amphibalanus amphitrite | XP_043236979.1 |
| Crassostrea virginica | XP_022292480.1 |
| Crassostrea gigas | XP_011446350.1 |
| Mytilus coruscus | CAC5390214.1 |
| Pomacea canaliculata | XP_025088006.1 |
| Mercenaria mercenaria | XP_045175493.1 |
qPCR analysis
qPCR was used to determine the relative mRNA expression of Mn-Plk1 in the different tissues. Table 1 lists the primers used for qPCR analysis, which was performed following previously described methods (39, 40). Briefly, RNAiso Plus Reagent was used to extract the total RNA from each tissue following the manufacturer’s protocol. After removing genomic DNA by gDNA Eraser, the total RNA was used to synthesize the cDNA template using PrimeScript™ RT reagent Kit (Takara) based on the manufacturer’s protocol. The UltraSYBR Mixture (CWBIO, Beijing, China) with the SYBR Green RT-qPCR assay was used to determine the expression level of Mn-Plk1 in each tissue, and the Bio-Rad iCycler iQ5 Real-Time PCR System (Bio-Rad, Hercules, CA, USA) was used to perform the qPCR analyses. The amplification protocols for qPCR analysis were 95°C for 10 min, followed by 37 cycles of 95°C for 10 s and 60°C for 1 min. All primers for qPCR analysis were listed in Table 3. The eukaryotic translation initiation factor 5A is a stable reference gene for qPCR analysis in M. nipponense, and it was used in the present study (41). The relative mRNA expression levels of Mn-Plk1 were calculated using on the 2−ΔΔCT comparative CT method (42).
| Primer name | Nucleotide Sequence(5′→3′) | TM | Amplification efficiency | Product size (bp) |
|---|---|---|---|---|
| PLK -RTF | CATGGGGGCTGTTACATACATTG | 65.6°C | 98.3% | 153 |
| PLK -RTR | GTTGAAGTCTTGACGCACATCAG | 65.3°C | ||
| IAG-RTF | CTGACCACACCTACTGAAGACAA | 64.7°C | 97.9% | 127 |
| IAG-RTR | CGTTTTCGATAAGAGGTCAAGCC | 64.9°C | ||
| EIF-F | CATGGATGTACCTGTGGTGAAAC | 65.2°C | 98.9% | 139 |
| EIF-R | CTGTCAGCAGAAGGTCCTCATTA | 65.1°C |
RNAi analysis
The potential function of Plk1 in reproductive development of male M. nipponense was investigated by RNAi, which has been widely used in gene functional analysis in this species. Table 1 lists the specific RNAi primer with a T7 promoter site, which was designed using Snap Dragon tools (http://www.flyrnai.org/cgibin/RNAifind_primers.pl↗) based on the ORF of Mn-Plk1. The Mn-Plk1 dsRNA (dsPlk1) was synthesized using the Transcript Aid™ T7 High Yield Transcription kit (Fermentas, Waltham, MA, USA) following the manufacturer’s protocol, and the green fluorescent protein dsRNA (dsGFP) was also synthesized and used as the negative control (43).
Six hundred male M. nipponense were collected from the Dapu M. nipponense Breeding Base and randomly divided into the dsPlk1 group (RNAi) and dsGFP group (control) (N = 300). These prawns were collected at approximately 5 months after hatching and had a body weight of 3.14−4.32 g. The dsPlk1 and dsGFP were injected into the prawns through the cardio coelom with the injected dose of 4 μg/g according to previously described methods (44). dsPlk1 and dsGFP were injected once and then again with the same dose after 7 days. Androgenic gland samples (N=15) were collected from both the control group and the RNAi group on days 1, 7, and 14 after dsGFP or dsPlk1 injection. The Mn-Plk1 mRNA expression levels were measured by qPCR to confirm the silencing efficiency. The mRNA expression of Mn-IAG was also measured using the same cDNA templates to analyse the regulatory relationship between Plk1 and IAG in M. nipponense.
Haematoxylin and eosin (HE) staining
The morphological differences between testis samples taken from the dsPlk1- and dsGFP-injected prawns were assessed by histological observations of tissues stained with HE. The histological observations were performed following previously described methods (45, 46). The slides were observed under an Olympus SZX16 microscope (Olympus Corporation, Tokyo, Japan). The cell types were labelled according to the previous studies (14, 15), and the numbers of each cell type were counted through the whole testis after the treatment of dsGFP and dsPlk1.
Statistical analysis
SPSS Statistics 23.0 (IBM, Armonk, NY, USA) was used to evaluate differences in Mn-Plk1 expression levels, followed the independent samples t-test and analysis of ANOVA variance (least significant difference and Duncan’s multiple range tests). Quantitative data were expressed as mean ± standard deviation. P < 0.05 and P < 0.01 were considered to be differentially expressed and significantly differentially expressed, respectively.
Results
Sequence analysis
The full-length cDNA sequence of Mn-Plk1 was 2,360 base pairs (bp) long, with a 5′ and a 3′ untranslated region of 92 bp and 432 bp, respectively. The ORF of Mn-Plk1 was 1,836 bp long and encoded 611 amino acids (Figure 1). The cDNA sequence of Mn-Plk1 was submitted to NCBI with the accession number OP379748↗. The theoretical isoelectric point of Mn-Plk1 was 4.90, and the molecular weight of the protein was 18.466 kDa.
The protein sequence of Mn-Plk1 shared over 80% identity with the Plk1 sequences from other crustacean species in NCBI based on the BLASTx analysis. The species included Procambarus clarkii (83.03%, XP_045623220.1↗), Penaeus monodon (82.42%, XP_037785985.1↗), Penaeus chinensis (82.42%, XP_047493190.1↗), Penaeus japonicus (82.06%, XP_042864001.1↗), and Penaeus vannamei (81.20%, XP_027211725.1↗) (Figure 2). Protein sequence alignment of Plk1 from different species revealed that Mn-Plk1 contains the common structure of Polo members, including a highly conserved N-terminal kinase and C-terminal protein binding domain (PBD). The conserved N-terminal kinase is composed of a serine/threonine kinase domain, of which the sub-domains I to XI have been labelled (Figure 2). The C-terminal PBD is composed of two Polo-boxes called Polo-box 1 and Polo-box 2 (Figure 2).
Nucleotide and deduced amino acid sequence of. The nucleotide sequence is displayed in the 5′–3′ directions and numbered at the left. The deduced amino acid sequence is shown in a single capital letter amino acid code. Arrows indicated the location and direction of each primer. 3′ UTR and 5′ UTR are shown with lowercase letters. Codons are numbered at the left with the methionine (ATG) initiation codon, an asterisk denotes the termination codon (TGA). Mn-Plk1
The similarity identity of amino acid sequences ofbetween different species. The Serine/Threonine (Ser/Thr) kinase domain composed of sub-domains I to XI is boxed. Important motifs and residues conserved in Ser/Thr kinases (HRDLKxN, KxxDFG, APE, DxWSxG and R) are indicated above the alignment. The asterisk indicates the position of the conserved T182 residue essential for kinase activation and the bullet point indicates the L104 residue involved in BI 2536 binding. The two Polo-box domains (PBD) are over-lined. Plk1
Phylogenetic tree analysis
The phylogenetic tree analysis revealed that the protein sequences of Plk1 from different species were mainly divided into two branches: crustacean species and mollusks species (Figure 3). Mn-Plk1 was clustered into the crustacean branch and had the closest evolutionary distance with that of crayfish, and then it clustered with the Plk1s of marine shrimp, followed by that of crabs. The evolutionary distance of Mn-Plk1 with Plk1s of mollusks species was much more distant.
The phylogenetic tree offrom different organisms based on amino acid sequence comparisons. Species names ofare listed on the right of the tree. Red asterisk indicated. Plk1 Plk1 M. nipponense
qPCR analysis
The qPCR analysis revealed that the highest expression of Mn-Plk1 occurred in the testis and ovary of male and female prawns, respectively, and it was significantly higher than the expression in the other tested tissues (P < 0.01). The expression levels in the testis and ovary were 505.56-fold and 840.39-fold higher than that of the female eyestalk, which had the lowest expression of all of the tested tissues. Mn-Plk1 expression levels were higher in the eyestalk, brain, heart, and hepatopancreas of male prawns than of female prawns, whereas the expression levels in the muscle, gonad, and gill showed the opposite pattern (Figure 4A).
Mn-Plk1 expression was widely detected during the whole developmental process of juvenile prawns, but peak expression occurred at the cleavage stage and was significantly higher than that at the other tested stages (P < 0.01). The expression levels during the larval and post-larval developmental stages (PL) generally remained stable and showed no significant differences (P > 0.05) (Figure 4B). The lowest expression of Mn-Plk1 was observed at PL25, and the value at cleavage stage was 117.57 folds higher than that of PL25.
The qPCR analysis also revealed that Mn-Plk1 expression was higher in the testis and androgenic gland from samples collected during the reproductive season than during the non-reproductive season. The values in the testis and androgenic gland from the reproductive season were 2.69-fold and 3.36-fold higher than those from the non-reproductive season, respectively, and the differences were statistically significant (P < 0.01) (Figure 5).
Measurement of theexpression in different mature tissues and developmental stages by qPCR.(a-d)expression in different mature tissues.expression in different developmental stages. E, eyestalk; Br, brain; H, heart; He, hepatopancreas; M, muscle; G, gonad; Gi, gill; CS, cleavage stage; BS, blastula stage, GS, gastrula stage; NS, nauplius stage; FS, posterior nauplius stage; PS, protozoea stage; GS, zoea stage; L, larval developmental stage; PL, post-larval developmental stage. Mn-Plk1 The amount of Mn-Plk1 mRNA was normalized to the EIF transcript level. Data are shown as mean ± SD (standard deviation) of tissues from three separate individuals. Lowercases on the bars indicate expression differences among all tissues from both sex (ANOVA). Capital letters (X, Y) on the bars indicate the expression differences in the same tissue between male and female prawns (independent sample T-test). Mn-Plk1 Mn-Plk1 (A) (B)
Measurement of theexpression in the testis and androgenic gland taken from different reproductive season.deviation(a, b)expression in the testis taken from different reproductive season.expression in the androgenic gland taken from different reproductive season. Mn-Plk1 The amount of Mn-Plk1 mRNA was normalized to the EIF transcript level. Data are shown as mean ± SD (standard ) of tissues from three separate individuals. Lowercases on the bars indicate expression differences between different samples (independent sample T-test). Mn-Plk1 Mn-Plk1 (A) (B)
RNAi analysis
In the RNAi experiment, qPCR analysis revealed that the Mn-Plk1 expression remained at a stable level in the androgenic gland after the injection of dsGFP (P > 0.05), whereas it was significantly decreased after the injection of dsPlk1. The decrease reached 94.8% and 88.9% at days 7 and 14, respectively, after the injection of dsPlk1 compared with the injection of dsGFP, and the values were significantly different (P < 0.01) (Figure 6A).
The expression of Mn-IAG in the same cDNA templates also remained at a stable level in the dsGFP-injected prawns (P > 0.05), but it decreased in the dsPlk-injected prawns. Decreases of > 55% and 60% were observed at days 7 and 14, respectively, in the dsPlk1 group compared to the dsGFP group (P < 0.01) (Figure 6B).
Histological observation revealed significant morphological differences between the testis from dsGFP- and dsPlk1-injected prawns. The cells in the testis were almost the same on different days after dsGFP injection, and sperm were the dominant cells, which were dramatically more than that of spermatogonia and spermatocyte (Figures 7A, B). However, the number of sperm decreased with time after dsPlk1 injection, while the percentages of spermatogonia and spermatocytes increased. Sperm (approximate 5%) were rarely observed on day 14 in dsPlk1-injected prawns, while over 80% cells were observed as spermatogonia (Figures 7A, C).
Measurement ofandexpression at different days afterandinjectioninjected prawns, while capital letters (X, Y and Z)prawns (ANOVA).PPofexpression at different days afterandinjection.of-expression at different days afterandinjection. Mn-Plk1 Mn-IAG dsPlk1 dsGFP . The amount of Mn-Plk1 and Mn-IAG mRNA was normalized to the EIF transcript level. Data are shown as mean ± SD (standard deviation) of tissues from three separate individuals. Lowercases (a and b) on the bars indicate the expression differences between different days in the dsGFP on the bars indicate expression differences between different days in the dsPlk1 *( < 0.05) and **( < 0.01) indicates significant expression difference between the RNAi group and control group at the sample day (independent sample T-test). Measurement Mn-Plk1 dsGFP dsPlk1 Measurement Mn IAG dsGFP dsPlk1 (A) (B)
SG, Spermatogonia; SC, spermatocyte; S, sperm. Scale bars = 20 μm.dsGFPdsPlk1dsGFPdsPlk1. The histological observations of testis between RNAi and control group. The histological observations of testis taken from the and injected prawns. The percentage of different cell types in the testis of injected prawns. The percentage of different cell types in the testis of injected prawns. (A) (B) (C)
Discussion
Plk1 plays vital roles in the regulation of maturation of centrosomes during the G2/M transition, the separation of centrosomes, and the activation of cyclin-dependent kinase 1 expression and spindle assembly during the cell cycle (26, 27). Plk1 was tested in therapies for primary colorectal cancer (29), prostate and pancreatic cancers (30), and rectal cancer (31). However, studies of the role of Plk1 in gonad development are scarce. A previous study predicted that Plk1 has potential functions in the reproductive development of male M. nipponense (14). In the present study, we investigated the regulatory functions of Plk1 in testis development of M. nipponense using qPCR, RNAi analysis, and histological observations.
BLASTx analysis revealed that the protein sequence of Mn-Plk1 shared over 80% identity with the Plk1 protein sequences from other crustacean species. Furthermore, protein sequence alignment analysis of Plk1 identified some common structures of Polo members, including a highly conserved N-terminal kinase with a serine/threonine kinase domain and a C-terminal PBD with two Polo-boxes, which was consistent with a previous report (33). These results indicated that the cDNA sequence obtained in this study was the Plk1 sequence of M. nipponense. The phylogenetic tree analysis showed a close evolutionary distance between Mn-Plk1 and the Plk1s of other crustacean species but a more distant relationship with those of mollusks species. Mn-Plk1 has the closest evolutionary distance with the Plk1 of P. clarkii, which is the only freshwater prawn with a Plk1 sequence in NCBI. Further studies should identify more Plk1 sequences from freshwater prawns in order to promote the evolutionary analysis of Mn-Plk1.
In humans, overexpression of Plk1 can promote mitosis and normal bipolar spindle assembly, while inhibition the Plk1 expression delays mitosis (47). However, no study to date has reported qPCR analysis of Plk1 in any aquatic species. In the present study, the highest expression of Mn-Plk1 mRNA occurred in the testis and ovary of male and female prawns, respectively, and it was significantly higher than expression levels in the other tested tissues (P < 0.01). This result suggests that Plk1 plays essential roles in the regulation of gonad development in M. nipponense and that the process of mitosis is much vigorous in the gonad than in the other tissues. In addition, Mn-Plk1 expression levels in the testis and androgenic gland collected during the reproductive season were 2.69-fold and 3.36-fold higher than those taken during the non-reproductive season, respectively. Previous studies identified significant morphological differences in these organs between the reproductive and non-reproductive seasons, with much greater development during the former than the latter (48, 49). These results indicate that Plk1 is a strong candidate gene for involvement in the reproductive development of male M. nipponense. Our data showed that the peak expression of Plk1 occurred at the cleavage stage, indicating the process of mitosis was strongest during this stage.
Knockdown of the expression of Plk1 by RNAi has been shown to inhibit the proliferation of pancreatic cancer (50) and colorectal cancer (51) cells. RNAi has also been widely used to identify the functions of male reproductive genes in M. nipponense (52, 53). In the present study, a > 85% decrease of Mn-Plk1 expression was observed in the androgenic gland of dsPlk1-injected prawns on days 7 and 14 compared to that of dsGFP-injected prawns, indicating that the synthesized dsPlk1 in the present study efficiently knocked down the expression of Plk1 in M. nipponense. Interestingly, the decreased Mn-Plk1 expression led to a significant decrease of Mn-IAG expression, indicating that Plk1 positively regulates IAG expression in M. nipponense. IAG has been proven to promote male sex differentiation and reproduction in crustacean species, especially testis development (16–18). Histological observation revealed morphological differences between the testis of dsPlk1- and dsGFP-injected prawns. For example, on day 14 approximate 5% of cells were identified as sperm in the prawns injected with dsPlk1, and this number was much lower than that in dsGFP-injected prawns. This result indicated that dsPlk1 had a significant inhibitory effect on testis development in M. nipponense.
In conclusion, our results indicate that Plk1 regulates testis development by affecting IAG expression in M. nipponense. These results provide valuable information that can be applied to establish artificial techniques to regulate testis development in this species through editing the gene sequence of Mn-Plk1 by CRISPR or knockdown the expression levels of Mn-Plk1 during the sex-differentiation sensitive period by RNAi.
Data availability statement
The original contributions presented in the study are included in the article/supplementary material. Further inquiries can be directed to the corresponding authors.
Ethics statement
Permission to conduct the experiments was obtained from the the Freshwater Fisheries Research Center (2021JBFM02, 12-06-2021). All experiments were performed in accordance with Jiangsu Laboratory’s Animal Management Guidelines (014000319/2008-00079). Written informed consent was obtained from the owners for the participation of their animals in this study.
Author contributions
ShJ wrote the manuscript. PW performed the RACE cloning, WZ analyzed the sequence characteristics. SuJ provided the experimental prawns. HQ performed the qPCR analysis. YG performed the RNAi analysis. YW performed the histological observations. YX revised the manuscript. HF supervised the manuscript. All authors contributed to the article and approved the submitted version.
Funding
This research was supported by grants from the Natural Science Foundation of Jiangsu Province (BK20221207), Central Public-Interest Scientific Institution Basal Research Fund, CAFS (2021JBFM02 and 2020TD36), National Key R&D Program of China (2018YFD0900201), Jiangsu Agricultural Industry Technology System (JATS2020461), China Agriculture Research System-48 (CARS-48), and New Cultivar Breeding Major Project of Jiangsu Province (PZCZ201745).
Conflict of interest
The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.
Publisher’s note
All claims expressed in this article are solely those of the authors and do not necessarily represent those of their affiliated organizations, or those of the publisher, the editors and the reviewers. Any product that may be evaluated in this article, or claim that may be made by its manufacturer, is not guaranteed or endorsed by the publisher.