PRD-2 controls casein kinase I and opposes RNA decay in the Neurospora biological clock

Genetic mapping and preliminary analyses identified prd-2 as a recessive mutant with an abnormally long ~26 hr period length that mapped to the right arm of LG V (Morgan and Feldman, 1997; Morgan and Feldman, 2001). Genetic fine structure mapping using selectable markers flanking prd-2, in preparation for an anticipated chromosome walk, revealed an extensive region of suppressed recombination in the region of the gene, consistent with the existence of a chromosome inversion (Lambreghts, 2012). PCR data consistent with this prompted whole genome sequencing that revealed a 322 kb inversion on chromosome V (Lambreghts, 2012) in the original isolate strain hereafter referred to as prd-2^INV. The left breakpoint of the inversion occurs in the 5’-UTR of NCU03775, and its upstream regulatory sequences are displaced in the prd-2^INV mutant. However, a knockout of NCU03775 (FGSC12475) has a wild-type circadian period length, unlike the long period prd-2^INV mutant (Figure 1—figure supplement 1). The next closest gene upstream of the left inversion is NCU03771, but its transcription start site (TSS) is >7 kb away. The right breakpoint of the inversion occurs in the 5’-UTR of NCU01019, disrupting 333 bases of its 5’-UTR and its entire promoter region (Figure 1A and B). A knockout of NCU01019 has a 26 hr long period, matching the prd-2^INV long period phenotype (Figure 1C). The prd-2^INV mutant has drastically reduced levels of NCU01019 gene expression in constant light conditions and in the subjective evening of a circadian free run (Figure 1D), suggesting that the inversion completely disrupts the NCU01019 promoter and TSS. Placing NCU01019 under the nutrient-responsive qa-2 promoter, we find that the long period length occurs at very low gene expression levels using 10⁻⁶ M quinic acid induction (Figure 1E). Finally, ectopic expression of NCU01019 at the csr-1 locus in the prd-2^INV background rescues the long period phenotype (Figure 1F). We conclude that PRD-2 is encoded by NCU01019.

We mapped the clock-relevant domains of the PRD-2 protein (Figure 2A), finding that both an SUZ domain and the proline-rich C-terminus of PRD-2 are required for a normal clock period. This result was confirmed in two separate genetic backgrounds either by replacing the endogenous locus with domain deletion mutants (Figure 2B) or by ectopic expression of domain mutants at the csr-1 locus in a Δprd-2 background (Figure 2C; Supplementary file 1). The SUZ domain family can bind RNA directly in vitro (Song et al., 2008), but curiously PRD-2’s adjacent R3H domain, which is better characterized in the literature as a conserved RNA-binding domain, is dispensable for clock function. The C-terminus of PRD-2 is predicted to be highly disordered, and finer mapping of this region showed that neither a glutamine/proline-rich domain (amino acids 525–612, 21% Gln, 26% Pro) nor a domain conserved across fungal orthologs (amino acids 625–682, 21% Pro) were required for normal clock function (Figure 2C). The remainder of the C-terminus (amino acids 495–524, 28% Pro; 683–790, 24% Pro) contains a clock-relevant region of PRD-2 based on deletion analyses. Further, PRD-2 SUZ domain and C-terminal deletion mutants are expressed at the protein level, indicating that clock defects must be due to the absent domain (Figure 2—figure supplement 1A). PRD-2 is exclusively localized to the cytoplasm based on biochemical evaluation, and this localization does not change as a function of time of day (Figure 2D).

NCU01019 RNA expression is not induced by light (Wu et al., 2014) nor rhythmically expressed over circadian time (Hurley et al., 2014). NCU01019 protein is abundant and shows weak rhythms (Hurley et al., 2018; Figure 2—figure supplement 1B), which suggests that PRD-2 oscillations are driven post-transcriptionally to peak in the early subjective morning, prior to the peak in the frq transcript (Aronson et al., 1994). Rhythms in PRD-2 protein expression were confirmed using a luciferase translational fusion (Figure 2—figure supplement 1C), which peaked during the circadian day. prd-2^INV and ΔNCU01019 have a slight growth defect (Figure 1C) and are less fertile than wild type as the female partner in a sexual cross (data not shown). Temperature and nutritional compensation of ΔNCU01019 alone are normal (Figure 2—figure supplement 2), which was expected given the normal TC profile of the prd-2^INV mutant (Gardner and Feldman, 1981). PRD-2 (XP_961631.1↗) is well conserved among Ascomycota fungi as noted by BLASTp scores (<e-70), while only its R3H and/or SUZ domains have significant similarity to insect and mammalian proteins: the encore gene in flies and the R3HDM1, R3HDM2, and ARPP21 genes in human and mouse.

To identify the putative mRNA targets of PRD-2, we performed total RNA-sequencing on triplicate samples of Δprd-2 versus control grown in constant light at 25°C. Hundreds of genes are affected by loss of PRD-2, but we did not identify a consensus functional category or sequence motif(s) for the putative PRD-2 regulon (Figure 3—figure supplement 1). Given the pleotropic phenotypes of Δprd-2, we posit that PRD-2 plays multiple roles in the cell, including regulation of carbohydrate and secondary metabolism. Focusing specifically on core clock genes, we found that ck-1a, frq, wc-2, ckb-1 (regulatory beta subunit of CKII), and frh were significantly altered in the absence of PRD-2 (Figure 3A). Pursuing the top two hits, we found that the CKI transcript was dramatically less stable in Δprd-2 (Figure 3B), while frq mRNA stability was not significantly altered (Figure 3—figure supplement 2). To demonstrate that PRD-2 binds the ck-1a transcript in vivo, we used RNA immunoprecipitation after UV cross-linking (CLIP). The Pumilio family RNA-binding protein PUF4 (NCU16560) was previously shown to bind in the 3’-UTR of cbp3 (NCU00057), mrp-1 (NCU07386), and other target genes identified by HITS-CLIP high-throughput sequencing (Wilinski et al., 2017). C-terminally tagged alleles of PRD-2, PUF4, and an untagged negative control strain were used to immunoprecipitate cross-linked RNAs (Materials and methods). As expected, cbp3 and mrp-1 positive controls were significantly enriched in the PUF4 CLIP sample compared to the negative IP (Figure 3C). ck-1a is also enriched in the PRD-2 CLIP sample, demonstrating that the CKI transcript is a direct target of the PRD-2 protein (Figure 3C).

Hypothesizing that the clock-relevant target of PRD-2 could be CKI, we used two genetic approaches to manipulate CKI activity in an attempt to rescue the Δprd-2 long period phenotype. First, we placed the ck-1a gene under the control of the quinic acid inducible promoter (Mehra et al., 2009) and crossed this construct into the Δprd-2 background. We found that increasing expression of ck-1a using high levels (10⁻¹ to 10⁻² M) of QA partially rescued the Δprd-2 long period phenotype (Figure 4A). We also noticed a synergistic poor growth defect in the double mutant at 10⁻⁴ M QA, consistent with low levels of ck-1a (an essential gene in Neurospora: Görl et al., 2001; He et al., 2006). There are two explanations for the lack of full rescue to periods shorter than 25 hr in the P_qa-2-ck-1a Δprd-2 double mutant: (1) even at saturating 10⁻¹ M QA induction, the qa-2 promoter may not reach endogenous levels of ck-1a achieved under its native promoter, and/or (2) because PRD-2 acts directly as an RNA-binding protein for CKI transcripts, simply increasing levels of ck-1a RNA cannot fully rescue PRD-2’s role in stabilizing or positioning CKI transcripts in the cytoplasm.

Next, we turned to a previously described fungal CKI constitutively active allele, CKI Q299^STOP (Querfurth et al., 2007), reasoning that we might be able to rescue low ck-1a levels in Δprd-2 by genetically increasing CKI kinase activity. We replaced endogenous CKI with a CKI^SHORT allele, which expresses only the shortest ck-1a isoform (361 amino acids). CKI^SHORT lacks 23 amino acids in the C-terminal tail of the full length isoform that are normally subject to autophosphorylation leading to kinase inhibition. This CKI^SHORT allele also carries an in-frame C-terminal HA3 tag and selectable marker, which displace the endogenous 3’-UTR of ck-1a. The CKI^SHORT mutant has a short period phenotype (~17 hr), presumably due to hyperactive kinase activity and rapid feedback loop closure (Liu et al., 2019). Significantly, the CKI^SHORT mutation is completely epistatic to Δprd-2 (Figure 4B), indicating that CKI is the clock-relevant target of PRD-2.

NMD in Neurospora crassa is triggered by various mRNA signatures. Open reading frames in 5’-UTRs that produce short peptides (5’-uORFs) can trigger NMD in a mechanism that does not require the Exon Junction Complex (EJC; Zhang and Sachs, 2015). The frq transcript has six such uORFs (Colot et al., 2005; Diernfellner et al., 2005) and could be a bona fide NMD target because its splicing is disrupted in the absence of NMD (Wu et al., 2017). Transcripts containing long 3’-UTRs are also subject to NMD regulation. In addition, transcripts with intron(s) near a STOP codon and/or with intron(s) in the 3’-UTR can be degraded by NMD after recruitment of the UPF1/2/3 complex by the EJC in a pioneering round of translation (Zhang and Sachs, 2015).

Since the observation by Compton, 2003 that the short period mutant prd-6 identified the UPF1 core subunit of the NMD pathway, the clock-relevant target(s) of NMD has been an object of conjecture and active research. Because loss of NMD reduces the amount of the transcript encoding the short-FRQ protein isoform (Wu et al., 2017), and strains making only short-FRQ have slightly lengthened periods (Liu et al., 1997), Wu et al., 2017 recently speculated that the short period of the upf1^prd-6 mutant might be explained by effects of NMD on FRQ. However, strains expressing only long-FRQ display an essentially wild-type period length (Colot et al., 2005; Liu et al., 1997), not a short period phenotype like upf1^prd-6; this finding is not consistent with FRQ being the only or even principal clock-relevant target of NMD, leaving unresolved the role of NMD in the clock.

To tackle this puzzle, we returned to classical genetic epistasis experiments and confirmed the observation that upf1^prd-6 is completely epistatic to prd-2^INV (Morgan and Feldman, 2001), going on to show that in fact each of the individual NMD subunit knockouts, ∆upf2 and ∆upf3 as well as Δupf1^prd-6, is epistatic to the Δprd-2 long period phenotype (Figure 5A). Previous work had profiled the transcriptome of Δupf1^prd-6 compared to a control (Wu et al., 2017); we re-processed this RNA-seq data and found, exactly as in Δprd-2, that ck-1a was the most affected core clock gene in Δupf1^prd-6 (Figure 5B). The ck-1a transcript has an intron located 70 nt away from its longest isoform’s STOP codon, and its 3’-UTR is, remarkably, among the 100 longest annotated UTRs in the entire Neurospora transcriptome (Figure 5C). NMD targeting to long 3’-UTR transcripts like ck-1a is thought to occur independently of the EJC and nuclear cap-binding complex (CBC) in Neurospora crassa (Zhang and Sachs, 2015). We used the knockout mutant Δcbp80 (NCU04187) to confirm that Neurospora CBC is not required for a normal circadian clock and that the long period length of Δprd-2 is unchanged in the Δcbp80 background (Figure 5—figure supplement 1). Thus, ck-1a is a strong candidate for NMD-mediated degradation via its long 3’-UTR, not dependent on EJC and CBC components.

We hypothesized that CKI is overexpressed in the absence of NMD (Figure 5B), leading to faster feedback loop closure and a short circadian period. To genetically control ck-1a levels, we crossed the regulatable P_qa-2-ck-1a allele into the Δupf1^prd-6 background and confirmed our hypothesis by finding that at low levels of inducer (10⁻⁵ M QA), decreased levels of ck-1a transcript revert the short period length of Δupf1^prd-6 to control period lengths (Figure 5D). Further, protein levels of CKI in the Δupf1^prd-6 background are reduced to control levels at 10⁻⁵ M QA (Figure 5E), which explains the period rescue phenotype. CKI protein is two to three times more abundant in Δupf1^prd-6 and in Δprd-2 Δupf1^prd-6 (Figure 5F), matching its overexpression in the Δupf1^prd-6 transcriptome (Figure 5B). CKI protein is 3× reduced in Δprd-2 (Figure 5F), also correlating with its reduced mRNA expression and stability (Figure 3). We conclude that CKI is also the clock-relevant target of UPF1^PRD-6, placing NMD, PRD-2, and CKI in the same genetic epistasis pathway.

The ras-1^bd prd-2^INV strains 613–102 (mat A) and 613–43 (mat a) were originally isolated in the Feldman laboratory (Lewis, 1995). Strains used in this study were derived from the wild-type background (FGSC2489 mat A), ras-1^bd background (87–3 mat a or 328–4 mat A), Δmus-51 background (FGSC9718 mat a), or the Fungal Genetics Stock Center (FGSC) knockout collection as indicated (Supplementary file 1). Strains were constructed by transformation or by sexual crosses using standard Neurospora methods (http://www.fgsc.net/Neurospora/NeurosporaProtocolGuide.htm↗).

The ‘c box-luc’ core clock transcriptional reporter was used to assay circadian period length by luciferase (Figure 2B, Figure 4B, Figure 5A, Figure 1—figure supplement 1, and Figure 5—figure supplement 1). In this construct, a codon-optimized firefly luciferase gene is driven by the clock box in the frequency promoter (Gooch et al., 2008; Hurley et al., 2014; Larrondo et al., 2015). The clock reporter construct was targeted to the csr-1 locus and selected on resistance to 5 μg/ml cyclosporine A (Sigma # 30024) (Bardiya and Shiu, 2007).

Standard race tube (RT) medium was used for all RTs (1× Vogel’s Salts, 0.1% glucose, 0.17% arginine, 1.5% agar, and 50 ng/ml biotin). Where indicated, D-quinic acid (Sigma # 138622) was added from a fresh 1 M stock solution (pH 5.8). Standard 96-well plate medium was used for all camera runs (1× Vogel’s Salts, 0.03% glucose, 0.05% arginine, 1.5% agar, 50 ng/ml biotin, and 25 μM luciferin from GoldBio # 115144-35-9). Liquid cultures were started from fungal plugs as described (Chen et al., 2009; Nakashima, 1981) or from a conidial suspension at 1 × 10⁵ conidia/ml. Liquid cultures were grown in 2% glucose liquid culture medium (LCM; 1× Vogel’s Salts, 0.5% arginine w/v) or in 1.8% glucose Bird Medium (Metzenberg, 2004) as indicated. QA induction experiments in liquid culture were performed in 0.1% glucose LCM medium with QA supplemented. All the experiments were conducted at 25°C in constant light unless otherwise indicated.

Strains were genotyped by screening for growth on selection medium (5 μg/ml cyclosporine A, 400 μg/ml Ignite, and/or 200–300 μg/ml Hygromycin). PCR genotyping was performed on gDNA extracts from conidia incubated with Allele-In-One Mouse Tail Direct Lysis Buffer (Allele Biotechnology # ABP-PP-MT01500) according to the manufacturer’s instructions. GreenTaq PCR Master Mix (ThermoFisher # K1082) was used for genotyping. Relevant genotyping primers for key strains are: ras-1^bd (mutant): 5’ TGCGCGAGCAGTACATGCGAAT and 5’ CCTGATTTCGCGGACGAGATCGTA 3’; ras-1^WT (NCU08823): 5’ GCGCGAGCAGTACATGCGGAC 3’ and 5’ CCTGATTTCGCGGACGAGATCGTA 3’; prd-2^WT (NCU01019): 5’ CACTTCCAGTTATCTCGTCAC 3’ and 5’ CACAACCTTGTTAGGCATCG 3’; Δprd-2::bar^R (KO mutant): 5’ CACTTCCAGTTATCTCGTCAC 3’ and 5’ GTGCTTGTCTCGATGTAGTG 3’; prd-2^INV (left breakpoint): 5’ AGCGAGCTGATATGCCTTGT 3’ and 5’ CGACTTCCACCACTTCCAGT 3’; prd-2^INV (right breakpoint): 5’ TGTTTGTCCGGTGAAGATCA 3’ and 5’ GTCGTGGAATGGGAAGACAT 3’; Δupf1^prd-6::hyg^R (FGSC KO mutant): 5’ CTGCAACCTCGGCCTCCT 3’ and 5’ CAGGCTCTCGATGAGCTGATG 3’; bar^R::P_qa-2-ck-1a (QA inducible CKI): 5’ GTGCTTGTCTCGATGTAGTG 3’ and 5’ GATGTCGCGGTGGATGAACG 3’.

Control and Δprd-2 liquid cultures grown in 1.8% glucose Bird medium were age-matched and circadian time (CT) matched to ensure that RNA stability was examined at the same phase of the clock. Control cultures were shifted to constant dark for 12 hr, and Δprd-2 cultures were shifted to dark for 14 hr (~CT1 for 22.5 hr wild-type period and for 26 hr Δprd-2 period; 46 hr total growth). Thiolutin (THL; Cayman Chemical # 11350) was then added to a final concentration of 12 μg/ml to inhibit new RNA synthesis. Samples were collected every 10 min after THL treatment by vacuum filtration and flash frozen in liquid nitrogen. THL has multiple off-target effects in addition to inhibiting transcription (Lauinger et al., 2017). For this reason, frq mRNA degradation kinetics were also examined with an alternative protocol. Light-grown, age-matched liquid Bird cultures of wild-type and Δprd-2 were shifted into the dark and sampled every 10 min to measure frq turnover; transcription of frq ceases immediately on transfer to darkness (Heintzen et al., 2001; Tan et al., 2004). All tissue manipulation in the dark was performed under dim red lights, which do not reset the Neurospora clock (Chen et al., 2009).

Frozen Neurospora tissue was ground in liquid nitrogen with a mortar and pestle. Total RNA was extracted with TRIzol (Invitrogen # 15596026) and processed as described (Chen et al., 2009). RNA samples were prepared for RT-qPCR, northern blotting, RNA-sequencing, or stored at −80°C.

For RT-qPCR, cDNA was synthesized using the SuperScript III First-Strand synthesis kit (Invitrogen # 18080–051). RT-qPCR was performed using SYBR green master mix (Qiagen # 204054) and a StepOne Plus Real-Time PCR System (Applied Biosystems). C_t values were determined using StepOne software (Life Technologies) and normalized to the actin gene (ΔC_t). The ΔΔC_t method was used to determine mRNA levels relative to a reference time point. Relevant RT-qPCR primer sequences are: prd-2 (NCU01019): 5’ GGGCAACGACGTCAAACTAT 3’ and 5’ TGCGTGTACATCACTCTGGA 3’, and actin (NCU04173): 5’ GGCCGTGATCTTACCGACTA 3’ and 5’ TCTCCTTGATGTCACGAACG 3’.

Northern probes were first synthesized using the PCR DIG Probe Synthesis Kit (Roche # 11 636 090 910). The 512 bp frq probe was amplified from wild-type Neurospora genomic DNA with primers: 5’ CTCTGCCTCCTCGCAGTCA 3’ and 5’ CGAGGATGAGACGTCCTCCATCGAAC 3’. The 518 bp ck-1a probe was amplified with primers: 5’ CCATGCCAAGTCGTTCATCC 3’ and 5’ CGGTCCAGTCAAAGACGTAGTC 3’. Total RNA samples were prepared according to the NorthernMax-Gly Kit instructions (Invitrogen # AM1946). Equal amounts of total RNA (5–10 μg) were loaded per lane of a 0.8–1% w/v agarose gel. rRNA bands were visualized prior to transfer to validate RNA integrity. Transfer was completed as described in the NorthernMax-Gly instructions onto a nucleic acid Amersham Hybond-N+ membrane (GE # RPN303B). Transferred RNA was cross-linked to the membrane using a Stratalinker UV Crosslinker. The membrane was blocked and then incubated overnight at 42°C in hybridization buffer plus the corresponding DIG probe. After washing with NorthernMax-Gly Kit reagents, subsequent washes were performed using the DIG Wash and Block Buffer Set (Roche # 11 585 762 001). Anti-Digoxigenin-AP Fab fragments were used at 1:10,000. Chemiluminescent detection of anti-DIG was performed using CDP-Star reagents from the DIG Northern Starter Kit (Roche # 12 039 672 910). Densitometry was performed in ImageJ.

Total RNA was submitted to Novogene for stranded polyA+ library preparation and sequencing. 150 bp paired-end (PE) read libraries were prepared, multiplexed, and sequenced in accordance with standard Illumina HiSeq protocols. 24.8 ± 1.7 million reads were obtained for each sample. Raw FASTQ files were aligned to the Neurospora crassa OR74A NC12 genome (accessed September 28, 2017, via the Broad Institute: ftp://ftp.broadinstitute.org/pub/annotation/fungi/neurospora_crassa/assembly/↗) using STAR (Dobin et al., 2013). On average, 97.6 ± 0.3% of the reads mapped uniquely to the NC12 genome. Aligned reads were assembled into transcripts, quantified, and normalized using Cufflinks2 (Trapnell et al., 2013). Triplicate control and Δprd-2 samples were normalized together with CuffNorm, and the resulting FPKM output was used in the analyses presented. RNA-sequencing data have been submitted to the NCBI Gene Expression Omnibus (GEO; https://www.ncbi.nlm.nih.gov/geo/↗) under accession number GSE155999↗.

CLIP was performed using PUF4 (NCU16560) as a positive control RNA-binding protein from Wilinski et al., 2017, with modifications. Neurospora strains containing endogenous locus C-terminally VHF tagged PUF4, PRD-2, or untagged negative control were used (Supplementary file 1). Liquid cultures were grown in 2% glucose LCM for 48 hr in constant light. Tissue was harvested by vacuum filtration and fixed by UV cross-linking for 7 min on each side of the fungal mat (Stratalinker UV Crosslinker 1800 with 254 nm wavelength bulbs). UV cross-linked tissue was frozen in liquid nitrogen and ground into a fine powder with a mortar and pestle. Total protein was extracted in buffer (25 mM Tris-HCl pH 7.4, 150 mM NaCl, 2 mM MgCl₂, 0.5% NP-40, 1 mM DTT, 1× cOmplete protease inhibitor, 100 U/ml RNAse Out) and concentration determined by Bradford Assay (Bio-Rad # 500–0006). Approximately 10 mg of total protein was added to 30 µl anti-FLAG M2 magnetic beads (Sigma # M8823) prepared according to the manufacturer’s instructions. Beads and lysate were rotated for 4 hr at 4°C, followed by four washes in 750 µl extraction buffer (5–10 min rotating per wash). Bound RNA-binding proteins were eluted with 100 µl 0.1 M glycine-HCl pH 3.0 for 10 min. The supernatant was collected using a magnetic rack (NEB S1506S) and neutralized in 10 µl of 1 M Tris-HCl pH 8.0. The elution was incubated with 300 µl of TRIzol (Invitrogen # 15596026) for 10 min to extract RNA. Total RNA was isolated, DNAse treated, and concentrated using the Direct-zol RNA Microprep Kit (Zymo # R2062) following the manufacturer’s instructions.

Equal amounts of immunoprecipitated RNA (~50 ng) were converted into cDNA using the oligo(dT) method from the SuperScript IV First-Strand synthesis kit (Invitrogen # 18091–050). RT-qPCR was performed using SYBR green master mix (Qiagen # 204054) and a StepOne Plus Real-Time PCR System (Applied Biosystems). C_t values were determined using StepOne software (Life Technologies) and normalized to the crp-43 gene (ΔC_t) instead of the actin (NCU04173) gene because actin is a putative PUF4 target by HITS-CLIP (Wilinski et al., 2017). The ΔΔC_t method was used to determine target mRNA enrichment relative to the negative IP sample. Relevant RT-qPCR primer sequences were designed to flank introns: cbp3 (NCU00057; PUF4 target): 5’ CGAGAAATTCGGCCTTCTCCC 3’ and 5’ GCCTGGTGGAAGAAGTGGT 3’; mrp-1 (NCU07386; PUF4 target): 5’ TAGTAGGCACCGACTTTGAGCA 3’ and 5’ CGGGGACAGGTGGTCGAA 3’; ck-1a (NCU00685; PRD-2 target): 5’ CGCAAACATGACTACCATG 3’ and 5’ CTCTCCAGCTTGATGGCA 3’; crp-43 (NCU08964; normalization control): 5’ CTGTCCGTACTCGTGACTCC 3’ and 5’ ACCATCGATGAGGAGCTTGC 3’.

Frozen Neurospora tissue was ground in liquid nitrogen with a mortar and pestle. Total protein was extracted in buffer (50 mM HEPES pH 7.4, 137 mM NaCl, 10% glycerol v/v, 0.4% NP-40 v/v, and cOmplete Protease Inhibitor Tablet according to instructions for Roche # 11 836 170 001) and processed as described (Garceau et al., 1997). Protein concentrations were determined by Bradford Assay (Bio-Rad # 500–0006). For western blots, equal amounts of total protein (10–30 µg) were loaded per lane into 4–12% Bis-Tris Bolt gels (Invitrogen # NW04125BOX). Western transfer was performed using an Invitrogen iBlot system (# IB21001) and PVDF transfer stack (# IB401001). Primary antibodies used for western blotting were anti-V5 (1:3000, ThermoFisher # R960-25), anti-Tubulin alpha (1:10,000, Fitzgerald # 10R-T130a), or anti-CK1a (1:1000, rabbit raised). The secondary antibodies, goat anti-mouse or goat anti-rabbit HRP, were used at 1:5000 (Bio-Rad # 170–6516, # 170–6515). SuperSignal West Pico PLUS Chemiluminescent Substrate (ThermoFisher # 34578) or Femto Maximum Sensitivity Substrate (ThermoFisher # 34095) was used for detection. Immunoblot quantification and normalization were performed in ImageJ.

Nuclear and cytosolic fractions were prepared as previously described (Hong et al., 2008). Approximately 10 μg of total protein from each fraction was loaded for immunoblotting. Primary antibodies for fraction controls were histone H3A (Fitzgerald) and γ-tubulin (Abcam). HRP-conjugated secondary antibodies (Bio-Rad) were used with SuperSignal West Pico ECL (Thermo) for detection.

96-well plates were inoculated with conidial suspensions from strains of interest and entrained in 12 hr light:dark cycles for 2 days in a Percival incubator at 25°C. Temperature inside the Percival incubator was monitored using a HOBO logger device (Onset # MX2202) during entrainment and free run. Plates were then transferred into constant darkness to initiate the circadian free run. Luminescence was recorded using a Pixis 1024B CCD camera (Princeton Instruments). Light signal was acquired for 10–15 min every hour using LightField software (Princeton Instruments, 64-bit version 6.10.1). The average intensity of each well was determined using a custom ImageJ Macro (Larrondo et al., 2015), and background correction was performed for each frame. Results from two different algorithms were averaged together to determine circadian period from background-corrected luminescence traces. The MESA algorithm was used as previously described (Kelliher et al., 2020). A second period measurement was obtained from an ordinary least squares autoregressive model to compute the spectral density (in R: spec.ar(…, method=‘ols’)). RT period lengths were measured from scans using ChronOSX 2.1 software (Roenneberg and Taylor, 2000).

All figures were plotted in R, output as scalable vector graphics, formatted using Inkscape, and archived in R markdown format. Data represent the mean of at least three biological replicates with standard deviation error bars, unless otherwise indicated.