What this is
- The p53 pathway is crucial in regulating cell fate during stress responses, particularly in neurodegenerative diseases.
- STAUFEN1 (STAU1), an RNA-binding protein, is overabundant in various neurological disorders and contributes to neuronal .
- This research investigates how reducing STAU1 levels can inhibit p53-mediated in different cell types and models of neurodegeneration.
Essence
- Reducing STAU1 levels prevents p53-mediated in various neuronal and non-neuronal cell types. This mechanism may offer a therapeutic strategy against neurodegeneration in conditions like ALS and FTD.
Key takeaways
- STAU1 reduction inhibits p53-mediated across multiple cell types, including human iPSC-derived neurons and fibroblasts. This suggests a novel role for STAU1 in modulating cellular responses to stress.
- In C9orf72-expanded patient-derived fibroblasts and a C9orf72 mouse model of ALS/FTD, lowering STAU1 levels effectively prevented pro-apoptotic signaling. This indicates the potential of targeting STAU1 as a therapeutic approach.
Caveats
- The study primarily focuses on in vitro models and may not fully replicate in vivo conditions. Further research is needed to confirm these findings in clinical settings.
- While STAU1 reduction shows promise, the long-term effects and potential side effects of targeting STAU1 in humans remain to be established.
Definitions
- apoptosis: Programmed cell death that is a normal part of growth and development, but can contribute to neurodegeneration when dysregulated.
- RNA-binding proteins (RBPs): Proteins that bind to RNA and play critical roles in regulating gene expression, including mRNA stability and translation.
Simplified
Background
The p53 pathway is a major signaling hub that determines cell fates in response to stress, and chronic activation of p53 in neurons can lead to neuronal dysfunction and death [1, 2]. Increasing evidence of p53-mediated apoptosis in ALS/FTD make it a valuable therapeutic target to reduce maladaptive stress responses and delay neuronal death [1 –3]. Repeat expansions in the C9orf72 gene cause ALS/FTD, associated with DNA damage and p53-mediated neuronal death, and ablation of p53 prevents neuronal death and extends the lifespan of multiple animal models [4 –9].
Interaction of p53 and its signaling network with RBPs help fine-tune the activation of the p53 pathway and the resulting responses and cell fates. RBPs interact with the p53 mRNA and regulate its stability, translation, splicing and interactions with non-coding RNAs, and with the p53 protein, regulating its localization and degradation [10 –12]. STAUFEN1 (STAU1) is a double-stranded RNA binding protein (RBP) with functions in RNA translation, splicing, stability, localization and decay [13 –15]. STAU1 becomes highly overabundant in multiple human neurological diseases, including amyotrophic lateral sclerosis (ALS), frontotemporal dementia (FTD), Parkinson's disease, Alzheimer's disease and spinocerebellar ataxia type 2 (SCA2) [14, 16 –24]; and also increases in response to acute stress [17 –20, 22, 23]. STAU1 overabundance contributes to neurodegeneration by promoting hyperactivation of the mTOR pathway, endoplasmic reticulum (ER) stress, autophagy dysfunction, RNA-protein condensates, amyloidogenesis, tau phosphorylation and neuronal apoptosis in cultured neurons and animal models of ALS, ALS/FTD and SCA2 (C9orf72, Thy1-TDP-43, and ATXN2Q127) [17 –19, 23 –25]. In the SCA2 mouse, decreasing Stau1 by genetic interaction protects Purkinje cells, normalizes autophagy through mTOR and improves motor function [19, 20, 23]. Similarly, in the transgenic TDP-43 mouse spinal cord, reducing STAU1 normalizes autophagy by mitigating mTOR hyperactivity, increasing CHAT levels, and preventing glial activation and apoptosis [19, 23]. These findings demonstrate that STAU1 is a potential therapeutic target that could simultaneously improve multiple pathological features.
Because reducing pathological elevations in the RBP STAU1 is protective in multiple models of neurodegeneration, triggered by various mutations that affect different neuronal populations, we hypothesized that STAU1 could modulate the p53 pathway to prevent neuronal apoptosis. We examined the global transcriptomic landscape after STAU1 knockdown (KD) and found the cellular immunity and apoptotic programs were inhibited, including the p53 pathway. In agreement, functional experiments in cultured human and mouse neurons, fibroblasts and SH-SY5Y cells demonstrated that STAU1 KD prevented DNA damage and p53-mediated apoptosis induced by etoposide or Nutlin-3. In addition, in C9orf72-patient-derived fibroblasts and in vivo in a C9orf72 expansion (BAC-C9-500) mouse, models of ALS/FTD, decreasing STAU1 was sufficient to prevent p53-mediated apoptotic signaling. Our findings reveal a novel role for STAU1 as a modulator of DNA damage, the p53 pathway, and apoptosis that could be harnessed to alter cell-fate decisions and prevent neurodegeneration.
Results
RNAseq highlights immunity and apoptosis pathways regulated by STAU1
Beginning with transcriptomic analysis in vitro, we examined the p53 pathway directly under conditions of STAU depletion in non-neuronal cells. This was followed by functional analysis in human neurons and finally in vivo using genetic interaction of ALS and STAU1-knockout (KO) mice.
Interrogation of canonical pathways using the Ingenuity Pathway Analysis (IPA) software revealed 241 significant pathways (with p ≤ 0.05) (Fig. 1C for the top 10, Supplemental Table 1 for the complete list). In our previous studies we described how STAU1 KD decreases the activity of eIF2 and mTOR, as well as their corresponding downstream targets [17 –19]. In agreement with this, the top 3 IPA canonical pathways in the current analysis were eIF2 signaling, regulation of eIF4 and p70S6K signaling and mTOR signaling (Fig. 1C). IPA analysis of the DEGs in the context of their pathway assigns a positive z-score to the pathways that are predicted to be activated and a negative z-score to pathways predicted to be inhibited [27]. Out of 241 significant canonical pathways, IPA assigned significant z-scores (z-score ≥ 2 or ≤ -2) [27] to 26 pathways (Fig. 1D). The top 3 canonical pathways eIF2 signaling, regulation of eIF4 and p70S6K signaling and mTOR signaling had significant or strongly trending negative z-scores, mirroring our previous findings and indicating an accurate IPA prediction of their functional inhibition (−5.859, −1.886 and −1.732 correspondingly, Fig. 1D, Fig. S3, SI Table 1 and 2) [17 –19].
IPA Upstream Regulator analysis identifies and predicts a positive or negative activation state for upstream transcription factors, microRNAs, kinases, compounds and drugs based on prior knowledge of their effects on the target genes in our dataset. Upstream analysis predicted an inhibition of the effects of multiple cytotoxic drugs with antineoplastic activity (camptothecin, prexasertib, etoposide and topotecan), along with a decrease in immune responses (TCR, Salmonella enterica LPS, poly rl:rc-rna, IFN-γ, diclofenac) (Fig. 2C). Several activated upstream regulators further support attenuation of cell death and immune responses by STAU1 KD (ESR1, Rictor, sirolimus), however some can promote cell death and positively modulate immune responses, depending on the context (CD24, PD98059, Mknk1, Tgfbr2, DSCAM) (Fig. 2C). Activity plots for predicted responses to etoposide and camptothecin show the z-scores for these compounds in the context of >47,000 datasets from the IPA database, indicating STAU1 KD has a profound effect (Fig. 2D).
The Upstream analysis of transcription and translation factors shows the top five factors with most significant p-values are MYC, MYCN and MLXIPL (belonging to the Myc/Max/Mad superfamily) and TP53 and LARP1(Fig. 2E, F, Fig. S4). All these factors can be regulated by mTORC1, and STAU1 binds to the mTOR 5'-UTR and controls its abundance and activity [19]. In addition, multiple other factors with significant p-values and z-scores were identified as upstream regulators (Fig. 2F, SI Table 2).
Altogether, STAU1 KD cells demonstrated extensive transcriptomic changes that suggest a cellular state of suppressed immune and apoptotic responses.

RNA-seq revealed a transcriptional signature of inhibition of apoptosis and immune responses byKD in HEK293 cells. STAU1 Volcano plot with highlighted DEGs.Modified gene sets identified by GSEA-Hallmark pathway analysis.Top 10 IPA canonical pathways ranked by-value.IPA canonical pathways with significant z-score and-value, ranked by z-score. A B C D p p

IPA functional and upstream analysis. Top 5 IPA results for Diseases and Bio Functions - Molecular and Cellular Functions.IPA results for "Cell death and Survival" category, ranked by-score.IPA Upstream analysis showing the top 10 significant positive and negative z-scores for upstream regulators, excluding transcriptional and translational regulators.IPA Activation plots for etoposide and camptothecin. Red dots indicate a singular dataset from the IPA database and the green circle indicates our sidataset.Top 5 IPA transcriptional and translational upstream regulators, ranked by-value.IPA upstream analysis showing all transcription and translation regulators with significant z-score. A B C D E F z STAU1 p
Decreased STAU1 attenuates apoptosis
Because the transcriptomic analysis indicated STAU1 KD could result in apoptotic resistance, we tested this hypothesis by treating cells with stressors that affect different cellular processes but converge at the activation of the intrinsic apoptosis pathway. We quantified cleaved Caspase-3 (cCaspase 3) and cleaved PARP (cPARP), as molecular effectors and markers of apoptosis [28, 29]. We utilized siRNA to KD STAU1 in HEK293 cells and an AAV coding for a miRNA targeting STAU1 in SH-SY5Y cells (AAV-PhP.eB-miSTAU1-45, due to low transfection efficiency), and additionally tested primary fibroblasts derived from Stau1-KO mice.

KD prevents apoptosis triggered by multiple stressors. STAU1 ,HEK293 cells were transfected withsiRNA and after 48 h. treated with the indicated compounds. Apoptosis was evaluated by quantifying the increase in cleaved Caspase-3 (cCaspase 3) and cleaved PARP (cPARP) by western blot.,SH-SY5Y cells were transduced with an AAV expressing a miRNA againstand treated with the indicated compounds after 36 h.Cell viability of SH-SY5Y cells quantified with a fluorogenic Gly-Phe-AFC assay.Western blots of primary fibroblasts fromandmice treated with etoposide. Graphs in–correspond to western blot quantifications after 3 independent experiments and data are presented as mean ± SEM. Statistical analysis was performed by one-way ANOVA followed by Sidak's multiple comparison test. * ≤ 0.05, ** ≤ 0.01, *** ≤ 0.001, **** ≤ 0.0001. A B C D E F A E STAU1 STAU1 Stau1 Stau1 P P P P +/+ −/−
Decreased STAU1 prevents DNA damage and pro-apoptotic p53 signaling
We also carried out a Comet assay, which detects DNA damage at the single cell level. Due to the assay's high sensitivity, our cells' baseline measurements after transfection left us with a narrow dynamic range and we were not able to meaningfully quantify DNA damage changes with this technique (Fig.). S6
To further support our findings, we studied primary skin fibroblast cultures from WT and Stau1 KO mice [33]. In WT fibroblasts, etoposide caused p53 stabilization and increased PUMA, associated with increased cCaspase 3, whereas in Stau1−/− fibroblasts their levels were indistinguishable from untreated cells (Fig. 4C).

KD decreased p53 pro-apoptotic signaling. STAU1 Western blots of SH-SY5Y cells treated with () etoposide (eto) or () Nutlin-3 (nut, 20 µM) for 6 or 18 h.Western blots of primary fibroblasts fromandmice (WT andKO) treated with etoposide 40 µM for 6 h. Graphs correspond to western blot quantifications after 3 independent experiments and data are presented as mean ± SEM. Statistical analysis was performed by one-way ANOVA followed by Sidak's multiple comparison test. * ≤ 0.05, ** ≤ 0.01, *** ≤ 0.001, **** ≤ 0.0001. A B C Stau1 Stau1 Stau1 P P P P +/+ −/−
STAU1 reduction blocks DNA damage and p53-driven apoptosis in neurons
In contrast with SH-SY5Y cells and fibroblasts, siSTAU1 did not reduce p53 activation in neurons; etoposide and Nutlin-3 induced p53 to the same level or higher (correspondingly) in control and STAU1 KD neurons. At the same time, induction of p21 in response to etoposide and Nutlin-3 was higher in the STAU1 KD neurons. The protein p21 is a key target of p53, and its activation promotes cell cycle arrest, DNA repair and inhibition of apoptosis [37 –39]. In addition to iNeurons, we studied primary mouse cortical neurons and found they mirrored the iNeuron results, with an increase in p21 after STAU1 KD (Fig. 5B). These results demonstrate that STAU1 KD can prevent DNA damage and p53-dependent apoptosis by harnessing the signaling pathway in a cell type and context-dependent manner.

KD prevents neuronal apoptosis mediated by p53. STAU1 Western blots of human induced neurons (iNeurons) transfected with a control orsiRNA twice (siControl, siSTAU1) and 48 h later treated with etoposide (eto, 40 µM) or Nutlin-3 (nut, 20 µM) for 6 h. cPARP was quantified normalized to a treated control because the levels in untreated cells were undetectable.Ilustrative photographs of iNeuron nuclei immunostained for γH2AX.Quantification of nuclei immunopositive for γH2AX in each condition. >300 nuclei per condition were counted, in 6 different fields from 3 independent culturesWestern blots of primary mouse cortical neurons in culture with a control ASO or an ASO targeting. Graphs correspond to western blot quantifications after 3 independent experiments and data are presented as mean ± SEM. Statistical analysis was performed by one-way ANOVA followed by Sidak's multiple comparison test. * ≤ 0.05, ** ≤ 0.01, *** ≤ 0.001, **** ≤ 0.0001. A B C D STAU1 STAU1 P P P P
Decreasedprevents p53 pro-apoptotic signaling triggered bymutation STAU1 C9orf72
To investigate whether STAU1 can modulate the p53 pathway to prevent apoptosis in vivo we utilized the C9orf72-500 mouse model of ALS/FTD [43]. We found that in spinal cords, STAU1, PUMA and cCaspase-3 were elevated (Fig. 6B). When crossed with Stau1−/− mice to produce C9orf72-500 mice haploinsufficient for Stau1, both PUMA and cCaspase-3 were reduced to levels comparable to WT mice (Fig. 6B). Thus, genetic reduction of Stau1 was sufficient to prevent p53-mediated apoptotic signaling in a mouse model of neurodegeneration caused by C9orf72-exp. Altogether, our results indicate reducing STAU1 abundance can effectively prevent p53 apoptotic signaling to protect from apoptosis in human and mouse cellular models and in vivo.

Reducing STAU1 levels prevents pro-apoptotic p53 signaling and attenuates apoptosis triggered byexpansion. C9orf72 Western blots of patient-derived fibroblasts expressing aexpansion and corresponding quantification graphs.Western blots of spinal cord lysates from-500 mice crossed withmice, and corresponding quantification graphs. Graphs correspond to western blot quantifications after 3 independent experiments and data are presented as mean ± SEM. Statistical analysis was performed by one-way ANOVA followed by Sidak's multiple comparison test. * ≤ 0.05, ** ≤ 0.01, *** ≤ 0.001, **** ≤ 0.0001. A B C9orf72 C9orf72 Stau1 P P P P -/−
Discussion
The p53 pathway is one of the major apoptotic signaling pathways and mounting evidence of its involvement in neurodegeneration positions it as a target for maintaining neuronal function and viability in multiple diseases. In this study, we identified a novel role for the RBP STAU1 in preventing DNA damage and p53-mediated apoptosis. With transcriptomic and functional analyses, we determined that in conditions of low STAU1 abundance, cells are resistant to apoptosis triggered by activation of p53, either by DNA damage or p53 stabilization (etoposide and Nutlin-3). We evidenced this in cell lines, human and mouse neurons in culture and in patient-derived fibroblasts and mice with C9orf72 expansions, models of ALS/FTD. These findings add the prevention of p53-mediated apoptosis to the multiple mechanisms of neuroprotection mediated by STAU1 depletion already described [17 –20].
The transcriptomic landscape of STAU1 KD cells indicated the acquisition of an anti-inflammatory and apoptotic resistant state, and identified multiple pathways and upstream regulators by which STAU1 could modulate p53-mediated apoptosis. These included the mTOR and PERK/p-eIF2α/CHOP pathways, which are harnessed by STAU1 in a bidirectional manner to either promote or prevent apoptosis [17 –20]. IPA and hallmark pathway analysis also predicted extrinsic apoptosis and immunity pathways to be functionally inhibited in response to STAU1 KD, mainly TGF-β, TNF-α, Nf-kB and Interferon response pathways. This could determine that STAU1 KD would not only prevent apoptosis triggered by intrinsic stress, but also in response to environmental factors and extracellular signaling. In neurological conditions, the inhibition of these pathways is predicted to limit the spread of neuroinflammation and non-cell autonomous neuronal death, whereas in cancer, evasion of immunosurveillance and apoptotic resistance would constitute a risk. Despite this, no propensity to tumorigenesis has been described in STAU1 KO mice [33, 44].
Transcriptional analysis placed the transcription factors MYC, MYCN, and MLXIPL (all belonging to the MYC/MAX/MAD superfamily) within the top 4 most likely functionally inhibited transcription factors. Canonically, c-MYC is required for efficient induction of p53-dependent apoptosis after DNA damage [45]. Previous studies have shown that STAU1 can interact with the 5'UTR of c-MYC to enhance its translation, increasing its mRNA and protein abundance, along with STAU1 KD decreasing c-MYC levels [46, 47]. Low c-MYC abundance promotes apoptotic resistance, while high levels increase apoptosis by repressing p21. This scenario mirrors STAU1 KD in neurons, with prevention of p53-mediated apoptosis associated with a p21 increase. It is therefore plausible that STAU1 KD could induce apoptotic resistance by decreasing c-MYC through its functions as an RBP.
While it is not a direct measurement of DNA damage, phosphorylation of Histone H2AX (γH2AX) at sites of DNA damage is one of the earliest detectable events, and it rapidly activates the DNA damage response (DDR) and checkpoint-mediated cell cycle arrest, serving as a widely accepted surrogate marker [48, 49]. After STAU1 KD, etoposide induced little to no γH2AX increase, suggesting STAU1 KD conferred protection against genotoxic stress. In agreement with this, transcriptome pathway analysis identified the nucleotide excision repair (NER) as functionally activated and UV response genes were enriched, indicating an enhancement in DNA repair pathways. In addition, IPA upstream-regulators analysis predicted an inhibited response to the genotoxic drugs etoposide and camptothecin. These results indicate STAU1 KD leads to transcriptomic changes that determine resistance to DNA damage, however, whether this mechanism is directly involved in preventing apoptosis remains to be studied.
STAU1 binds to different types of STAU1-binding sites (SBS) in double stranded RNA. Binding to the 5'UTR SBS or specific coding regions can enhance the translation of the mRNA while binding to the 3'UTR recruits UPF-1 to trigger Staufen-mediated decay (SMD) degradation of the mRNA or prevent its translation [44, 50 –55]. Through these functions STAU1 can post-transcriptionally regulate a multitude of target mRNAs, affecting numerous cellular networks.
After DNA damage or Nutlin-3 exposure, p53 protein abundance rapidly increases and activates downstream transcriptional targets that will determine cell fate. We found that in dividing cells, STAU1 KD prevented the increase of p53 and downstream apoptotic effectors. In contrast, in human and mouse neurons, STAU1 KD did not decrease p53 levels, but its signaling, however, shifted from apoptotic to pro-survival, inducing p21. The protein p21 is a major target of p53, preventing neuronal death by blocking cell cycle re-entry signaling, promoting DNA repair, reducing oxidative stress and inhibiting caspase-3, among other homeostatic functions [38 –40]. Therefore, it is likely that the neuroprotective effect of STAU1 KD is mediated by fine-tuning p53 signaling and its downstream effectors, shifting the therapeutic paradigm of achieving neuroprotection by merely reducing p53 levels. However, whether STAU1 KD causes sustained p21 activation and subsequent neuronal senescence remains to be investigated. [37 –39, 56]. Despite the mechanistic differences, STAU1 KD promoted survival in all cell types studied. These results indicate that blocking the activation of the p53 pathway is not required for STAU1 KD to prevent p53-mediated apoptosis; and that STAU1 is likely to act upstream of the p53 pathway, leading to cell- and context-dependent responses that determine apoptotic resistance.
The accumulation of DNA damage and activation of its associated signaling pathways are now recognized as major drivers of neurodegeneration and brain aging. Dividing glial cells are highly susceptible to DNA damage during replication, whereas post-mitotic neurons must maintain their genomic integrity throughout their lifespan. In dividing cells, STAU1 KD could potentially protect against this damage by triggering cell cycle arrest. However, the effect of reducing STAU1 levels varies by cell type—it impairs proliferation in non-transformed cells but does not affect transformed cells [57, 58]. In our study, we examined HEK293 cells, SH-SY5Y cells, mouse primary cortical neurons, iPSC-derived neurons, and patient-derived fibroblasts, encompassing transformed, non-transformed, and post-mitotic cells. Regardless of cell type and mitotic status, lowering STAU1 consistently reduced γH2AX levels and apoptosis. These findings suggest that the protective mechanisms that we observed are independent of the cell cycle.
Pathological increases in STAU1 are observed across the nervous system in multiple models of neurodegeneration, triggering ER stress, autophagy defects and neurodegeneration [17 –20, 23]. In post-mortem spinal cords of sporadic and C9orf72-ALS patients and muscle of DM1 patients, STAU1 is also highly overabundant [17, 59]. A survey of patient-derived fibroblasts with mutations in TDP-43, MAPT, PSEN1, C9orf72 and HTT found increased STAU1 in all [18 –20]. Likewise, in cellular and animal models of ALS/FTD (TDP-43 and C9orf72) and SCA2 (ATXN2-Q127), decreasing STAU1 by RNAi or genetic interaction reverses molecular markers of ER stress, defective autophagy, protein aggregates, neuronal death and glial activation, and improves the behavioral motor phenotype of SCA2 mice [17 –19]. In addition, we now show decreasing STAU1 can prevent DNA damage and neurodegeneration mediated by the p53 pathway.
A growing body of evidence implicates DNA damage and p53 in the pathogenesis of ALS/FTD [60, 61]. P53 is strongly activated in C9orf72, TARDBP and sporadic ALS/FTD post-mortem tissue, iPSC-motor neurons and animal models [4 –6, 8, 40, 62 –66]. Nuclear TDP-43 depletion, knockdown or overexpression causes DNA damage and robust p53 upregulation [4, 40, 64, 67 –69]. DNA damage, somatic mutations, gene fusions, the DNA damage response and p53 activation are established hallmarks of neurodegeneration caused by C9orf72 repeat expansions in ALS/FTD [4 –9]. C9orf72-toxicity triggers p53-PUMA dependent neurodegeneration, and in a C9orf72 mouse model (expressing the dipeptide repeat poly(PR)) ablating p53 completely prevents neuronal death and extends their lifespan [40]. In agreement with this, we found patient-derived fibroblasts with C9orf72-exp had increased levels of PUMA, p21 and cleaved caspase 3, which STAU1 KD normalized. In the C9orf72-500 mouse spinal cord, PUMA and cleaved caspase 3 were also increased, and heterozygosity for Stau1 was sufficient to normalize them, demonstrating that STAU1 can prevent p53 apoptotic signaling in ALS/FTD in vivo.
Our findings show that STAU1 reduction results in protection against DNA damage and resistance to apoptosis induced by p53 in neurodegeneration. Because STAU1 is ubiquitously expressed and is increased in numerous neurodegenerative diseases and by acute stress, our findings constitute a novel mechanism to modulate p53-controlled cell fates that could be harnessed to prevent neuronal stress and apoptosis.
Materials and methods
A detailed list of all materials, experimental models and software can be found in SI Table. 3
Cell culture, transfection, transduction and treatment
Cell culture media and reagents were purchased from Thermo Fisher Scientific unless otherwise specified. HEK293 cells, mouse skin fibroblasts and human skin fibroblasts were grown in DMEM supplemented with 10% fetal bovine serum and 1X penicillin and streptomycin.
Mouse primary fibroblasts were obtained by culturing ~3 mm skin explants attached to a cell culture dish for 2–3 weeks. Explants were then removed and fibroblasts were passaged 2–3 times before experimentation.
Human fibroblasts ND38530 (normal) and ND42506 (GGGGCC repeat expansion>24; in 1st intron – individual at risk for FTD) were obtained from the Coriell Cell Repositories (Camden, NJ, USA).
Identity authentication of HEK293, SH-SY5Y cells and human fibroblasts was carried out by short tandem repeat (STR) analysis with the GenePrint 24 System (Promega, USA) and PCR mycoplasma testing was carried out regularly.
Lipofectamine 2000 was used for all siRNA and plasmid transfections, according to the manufacturer's instructions. STAU1 siRNA was used at 100 μM, and subsequent pharmacological treatments were added 48 h after transfection in fresh media.
Primary culture of cortical neurons
Mice were bred and handled according to the protocol for ethical use of animals for research approved by the University of Utah IACUC (protocol number 00002040). Primary cortical neuron cultures were prepared from neonatal mice [70, 71]. Brain cortices from 6–7 animals were isolated and incubated with 50 units of papain (Worthington) in Earle's balanced salt solution (EBSS) with 1mM L-cysteine and 0.5 mM EDTA for 15 min at 37 °C, followed by washing in EBSS and mechanical trituration. The remaining tissue was removed by filtration through a 50 µm strainer (Falcon). Neurons were seeded at 50,000 per cm2 on plates coated with poly-L-ornithine and laminin in Neurobasal Plus medium containing 2% B27 Plus supplement (Life technologies) and glutamax 0.5 mM. On day 2 10 µM cytosine arabinoside was added for 24 h to prevent proliferation of glial cells and 75% of culture medium volume was replenished every 2–3 days from there on. After 2 weeks in culture, we added ASO against STAU1 or a non-targeting control ASO for overnight gymnotic delivery. Neurons were treated 48 h later.
Culture and differentiation of iPSCs
The iPSC line KOLF2.1 J AAVS-TO-NGN2 was a gift from Michael Ward (NIH, Maryland) and Bill Skarnes (Jackson laboratories, Connecticut) as part of the iPSC Neurodegenerative Disease Initiative (iNDI) and has been previously validated [72]. iPSCs were cultured on Geltrex substrate with StemFlex cell culture media. For differentiation, iPSCs were passaged using Accutase (Sigma) and plated at high density on Geltrex substate. For the first 3 days cells were grown in Induction Media composed of DMEM/F12 supplemented with 1% N2, 1% NEAA and 1% GlutaMax, with the addition of 2 μg/mL doxycycline (Sigma), with daily media changes. On day 3 cells were dissociated with Accutase and plated on Geltrex substrate in 12 well plates at a density of 5 × 104 cells per well. The next day, media was changed to Maturation Media, composed of Neurobasal Plus supplemented with 1% B27 Plus, 1% N2, 10 ng/mL BDNF (StemCell) and 2 μg/mL doxycycline. Doxycycline was discontinued on day 8. 50% of the media was replaced with fresh media 2-3 times per week. iN from at least two different batches of differentiation were used for experiments. iN were transfected between days 15 and 20 after initial induction with Lipofectamine RNAiMAX and 400 nM siSTAU1 or siControl, overnight, for 2 consecutive days, and experiments were carried out 48 h after the last transfection.
Immunofluorescence
For immunofluorescence analysis iNeurons were plated on coverslips coated with geltrex on day 3 of differentiation, transfected on days 4 and 5 and on day 7 treated with etoposide for 2 h. iNeurons were pre-fixed by adding 4% paraformaldehyde into the cell culture media and incubating for 15 min, then fixed for further 15 minutes by replacing the entire volume of media with paraformaldehyde 4%. iNeurons were permeabilized and blocked for 1 h with 5% goat serum and 0.1 Triton X-100 in PBS, then incubated with γH2AX antibody at a 1:500 dilution overnight. The secondary antibody was an Alexa Fluor Plus 594 used at a 1:1000 dilution for 1 h. Images were acquired with a Nikon widefield microscope or a Leica SP8 at the Cell imaging core of the University of Utah.
Construction of AAV vector and production of viral particles
The plasmids used to generate adeno associate virus (AAV) include the single-strand AAV expression plasmid, pAAV-U6-sgRNA-CMV-GFP, (gift from Hetian Lei; Addgene plasmid # 85451), and pUCmini-iCAP-PHP.eB, (gift from Viviana Gradinaru; Addgene, plasmid # 103005), and pHelper (Stratagene, La Jolla, CA, USA). The STAU1 miRNA DNA insert "CGAGTGAGCGCTAACTGCCATGATAGCCCGAGCTGTAAAGCCACAGATGGGCTCGGGCTATCATGGCAGTTACCGCCTACTATTTTTTA" was cloned downstream of the U6 promoter of sgRNA pre-depleted AAV-U6-CMV-GFP plasmid using Sac I and Spe I restriction sites and designated as pAAV-U6-iSTAU1-45F(h + m)-CMV-GFP. The plasmid constructs were verified by sequencing. Recombinant AAV particles were generated as previously described [73] with minor modifications. HEK293T cells were co-transfected with three plasmids: either pAAV-U6-CMV-GFP (control) or pAAV-U6-iSTAU1-45F(h + m)-CMV-GFP along with pUCmini-iCAP-PHP.eB and pHelper, at a ratio of 1:4:2 (based on micrograms of DNA; ~ 30 μg of total DNA per 10 cm dish) using lipofectamine 2000 transfection reagent (ThermoFisher Scientific) according to the manufacturer's protocol. After 12–18 h media was changed and incubated for further 72 h. Cells were then harvested and lysed in 25 mM Tris, pH 8.5, 150 mM NaCl with repeated freezing and thawing cycles using liquid nitrogen and a 37 °C water bath, followed by centrifugation at 4 °C for 30 min at 14,000 rpm. The resultant supernatants containing AAV-PhP.eB-Control or AAV-PhP.eB-miSTAU1-45 were filtered and stored at −80 C. SH-SY5Y cells were incubated overnight with these AAVs in a 1:4 dilution with fresh media, and experiments were conducted 48 h later.
Viability assay
For quantification of cell viability, we used the Cell-Titer Fluor Viability Assay (Promega), a glycyl-phenylalanyl-aminofluorocoumarin based-assay. SH-SY5Y cells were plated in black 96 well plates with optical bottoms, and the assay was carried out according to the manufacturer's protocol.
Mice
All mice were housed and bred in standard vivarium conditions and experimental procedures were approved by the Institutional Animal Care and Use Committee (IACUC) of the University of Utah. The Stau1tm1Apa(−/−) (Stau1−/−) mouse was a generous gift from Prof. Michael A. Kiebler, Ludwig Maximilian University of Munich, Germany and genotyped according to published protocols [33]. Stau1−/− mice were maintained in a C57BL/6 J background.
FVB/NJ-Tg(C9orf72)500Lpwr/J mice [43] were purchased from JAX Laboratories and backcrossed to C57BL/6 J. C9-500 mice were first genotyped with a multiplex PCR amplifying mouse actin with JAX primers 21238 F and 21239 R, and human C9orf72 primers amplifying across exon 10 (C9Ex10F) and exon 11 (C9Ex11R) producing a 415 bp and 320 bp amplicon, respectively. PCR was performed with an initial denaturation at 95 °C for 5', 30 cycles of 95 °C for 1', 60 °C for 30" and 72 °C 1' with a final extension of 72 °C for 5'. The amplicon was run on a 3% agarose gel and detected with ethidium bromide. The G4C2 repeat expansion was then verified utilizing previously published Repeat Prime PCR protocol [74]. Only animals verified to be non-mosaic and with a repeat expansion greater than 200 bp were utilized. C9-500 mice were crossed with Stau1−/− mouse to generate C9-500/Tg Stau1(+/−), C9-500/Wt Stau1(+/−), C9-500/Tg Stau1(+/+) and C9-500/Wt Stau1(+/+) in a mixed background of FVB/NJ and C57BL/6 J.
RNA sequencing and analysis
Total RNA was extracted from tissues using the RNeasy Mini-Kit (Qiagen) according to the manufacturer's protocol. RNA quality was determined using the Agilent ScreenTape Assay. Library preparation was performed using the Illumina TruSeq Stranded Total RNA library prep Ribo-Zero gold. Paired-end 150 bp reads were generated on a Novaseq 6000 S2 cell sequencing instrument at the High-Throughput Genomics and Bioinformatic Analysis Shared Resource at Huntsman Cancer Institute (University of Utah). The human GRCh38 genome and gene annotation files were downloaded from Ensembl release 100 and a reference database was created using STAR version 2.7.3a with splice junctions optimized for 150 base pair reads [75]. Optical duplicates were removed from the paired end FASTQ files using clumpify v38.34 [76] and reads were trimmed of adapters using cutadapt 1.16 [77]. The trimmed reads were aligned to the reference database using STAR in two pass mode to output a BAM file sorted by coordinates. Mapped reads were assigned to annotated genes using featureCounts version 1.6.3 [78]. The output files from cutadapt, FastQC, FastQ Screen, Picard CollectRnaSeqMetrics, STAR and featureCounts were summarized using MultiQC to check for any sample outliers [79]. Differentially expressed genes were identified for siSTAU1 vs siControl using a 5% false discovery rate with DESeq2 version 1.26.0 [80]. Pathways were analyzed using the fast gene set enrichment package with a 10% false discovery rate [81]. For IPA, we used a 5% false discovery rate and a log2FC cutoff of -0.1 and 0.1.
Western blot
Protein homogenates from cultured cells were prepared by scraping cells in phosphate buffered saline and lysing the pellets in Laemmli sample buffer (Bio-Rad), followed by boiling for 5 min [82]. HEK293 protein extracts for detection of p53 were diluted 1:10. Mouse spinal cords were hydraulically ejected and protein extracts were prepared by homogenization in extraction buffer (25 mM Tris-HCl pH 7.6, 300 mM NaCl, 0.5% Nonidet P-40, 2 mM EDTA, 2 mM MgCl2, 0.5 M urea and protease inhibitors) followed by centrifugation at 4 °C for 20 min at 14,000 RPM. Supernatants were then diluted in laemmli sample buffer and boiled.
Proteins were resolved by SDS-PAGE and transferred to Hybond P membrane (Amersham Bioscience), blocked in Tris-buffered saline 0.1% Tween-20 with 5% skim milk and primary antibody was incubated overnight in this same solution. After incubation with the corresponding secondary antibody signal was detected using Immobilon Western Chemiluminescent HRP Substrate (EMD Millipore) or SuperSignal™ West Pico PLUS Chemiluminescent Substrate (ThermoFisher Scientific) and photographed with a Bio-Rad ChemiDoc. Analysis and quantification were performed with Image Lab software (Bio-Rad). Relative protein abundance was first normalized against actin band intensity and then expressed as the ratio to the normalized control.
Comet assay
We used the CometAssay Single Cell Gel Electrophoresis Assay kit from BioTechne, according to the manufacturer's instructions. The percentage of DNA in tail was quantified in ImageJ with the OpenComet plug-in [83].
Statistical analysis
All results are presented as mean ± standard error of the mean (SEM) unless noted otherwise. For western blot quantifications 3 independent experiments were carried out and the means for each group were compared with an Ordinary one-way ANOVA followed by Sidak's multiple comparison test in the GraphPad Prism software.
Ethics approval and consent to participate
All mice were housed and bred in standard vivarium conditions and experimental procedures were approved by the Institutional Animal Care and Use Committee (IACUC) of the University of Utah under protocol number 16-09007.
The KOLF2.1 J AAVS-TO-NGN2 cell line was obtained from Dr. Michael Ward and Dr. William Skarnes. The parental KOLF2.1 J iPSC line was produced according to all regulations and informed consent of the NRES Committee Yorkshire & The Humber Leeds West, approval number 15/YH/0391.
Supplementary information
Supplemental material Table 3 Full length uncropped original Western blots




