Substances Released by Human Placental Stem Cells Reduce Signs of Cell Aging

Passage 7 hTSCs grew robustly in culture, as assessed on phase‐contrast micrographs (Figure 1a), and were a highly pure population, displaying canonical stem cell markers CD90 and CD105 (> 95% positive) and minimal levels of the pan‐hematopoietic marker CD45 (1.05% positive), as assessed by flow cytometry (Figure 1a). These features persisted through passages 11 and 19 (Figure S1a). To evaluate the impact of hTSC‐CM on senescent cells, we prepared conditioned medium (CM) collected from hTSCs (Methods) and used fresh, non‐conditioned medium (NCM) in control incubations. We triggered senescence employing a well‐established cell model, human diploid WI‐38 fibroblasts, using two different paradigms. In one, WI‐38 fibroblasts were exposed to ionizing radiation (IR, 10 Gy) once on Day 1 after plating (Day 0); IR causes single‐ and double‐strand breaks on the DNA that promote senescence and activate NF‐κB, which in turn increases the transcription of genes encoding SASP factors. Immediately after exposure to IR, cells were incubated for 5 days with either hTSC‐CM or NCM, refreshing the medium on Day 3, as shown (Figure 1c). In the other, etoposide (Eto, 50 μM) was added to the culture medium on Day 1, and refreshed on Day 3; cells were collected on Day 5. The continuous exposure to Eto stabilizes TOP2‐DNA cleavage complexes in cells, which generates double‐strand DNA breaks that promote senescence, activate NF‐κB, and enhance the SASP trait. Along with the addition of Eto, WI‐38 fibroblasts also received NCM or hTSC‐CM on Days 1 and 3 (Figure 1c).

To evaluate the effect of hTSC‐CM relative to the control incubation (NCM) on senescence traits, we performed several measurements. By Day 5, IR‐treated fibroblasts incubated with hTSC‐CM displayed lower percentages of cells positive for senescence‐associated β‐galactosidase activity (SA‐β‐Gal) than fibroblasts incubated with NCM (Figure 1d); likewise, both the density and numbers of IR‐treated fibroblasts increased when cultured in hTSC‐CM as compared to NCM (Figure S1b). By Day 5, IR‐treated fibroblasts cultured in hTSC‐CM or NCM were collected, and reverse transcription (RT) followed by quantitative (q)PCR analysis was used to measure the levels of several mRNAs. As shown, fibroblasts cultured with hTSC‐CM expressed higher levels of MKI67 mRNA, encoding the proliferation marker Ki‐67 (Mansfield et al. 2024), than fibroblasts cultured in NCM (Figure S2c). Conversely, the levels of SASP‐related transcripts, including IL8, CXCL1, GDF15, TGFB1, BAFF, and ICAM1 mRNAs, were significantly lower in WI‐38 cells incubated with hTSC‐CM than in cells incubated with NCM (Figure 1e).

We validated the specificity of the effects of hTSC‐CM after triggering senescence in WI‐38 cells by exposure to Eto following the same timeline as for IR (Figure 1c). Similarly to what was seen after IR, incubation with hTSC‐CM markedly decreased the levels of SASP‐associated transcripts after Eto‐induced senescence, as compared with incubation with NCM (Figure 1f). Collectively, these findings indicate that in cells induced to undergo senescence, incubation with hTSC‐CM dampened senescence traits, as it reduced growth arrest, SA‐β‐Gal activity, and the expression of mRNAs encoding SASP factors.

To comprehensively evaluate the effects of hTSC‐CM on senescent cells, we conducted high‐throughput analysis of the transcriptome and secretome of WI‐38 cells after exposing them to senescence‐inducing damage and culturing them in hTSC‐CM or NCM. Following exposure to IR, WI‐38 fibroblasts were incubated with hTSC‐CM or NCM; on Day 5, RNA‐sequencing (RNA‐seq) analysis (GSE282054) revealed a broad reduction in the levels of SASP‐associated mRNAs in WI‐38 fibroblasts incubated with hTSC‐CM relative to those incubated in NCM. Among the reduced mRNAs in fibroblasts incubated with hTSC‐CM were those that encode SASP factors (CXCL1, IL8, and GDF15 mRNAs), and particularly several matrix metalloproteinases (MMP1, MMP3, and MMP9 mRNAs), known mediators of inflammation, extracellular matrix remodeling, and tissue damage (Figure 2a and Table S1). Gene Ontology (GO) analysis of mRNAs showing reduced abundance, performed using ShinyGO, revealed that several biological pathways associated with the SASP were affected by incubation with hTSC‐CM, including the CXCR chemokine receptor binding pathway, metalloendopeptidase activity, cytokine activity, and signaling receptor ligand activity (Figure 2b). GO analysis of mRNAs showing increased abundance indicated an enrichment in pathways involved in ECM collagen, plasma membrane signaling, and structural integrity (Figure S1). These findings suggest that culture with hTSC‐CM not only suppressed SASP‐related inflammation but it also actively promoted ECM integrity, fostering a more regenerative cellular environment.

To further assess the impact of hTSC‐CM on the secretion of SASP factors, we performed Olink proteomic analysis to compare the secretory profiles of WI‐38 fibroblasts cultured in hTSC‐CM relative to those cultured in NCM (Table S2). Several pro‐inflammatory cytokines, including IL6, GDF15, and CXCL1, were less abundant in the hTSC‐CM‐treated group (Figure 2c), mirroring the RNA‐seq data, and suggesting a coordinated suppression of both mRNAs encoding SASP factors and the secretion of such SASP factors by senescent WI‐38 cells in the presence of hTSC‐CM. Several other proteins were more abundantly secreted by WI‐38 cells after incubation with hTSC‐CM (Figure 2d), suggesting a broad reprogramming of the secretory profile.

The results obtained using the Olink platform were further evaluated by Bio‐Plex analysis. In the same paradigm of fibroblasts treated with IR and incubated with hTSC‐CM or NCM, Bio‐Plex analysis confirmed a reduction in the levels of individual SASP factors (IL6, IL8, GDF15, MMP3, and others) after incubation with hTSC‐CM (Figure 2e). Collectively, these findings support the notion that hTSC‐CM broadly suppresses the production and secretion of SASP factors by senescent fibroblasts.

To understand how hTSC‐CM might suppress the SASP, we comprehensively analyzed the protein content in hTSC‐CM using Olink proteomics, cytokine arrays, and Bio‐Plex multiplex assays, as outlined in Figure 3a. Olink proteomic analysis followed by CellMarker analysis revealed that a number of diverse cell types contributed to the proteome present in hTSC‐CM, including stem cell cartilage, stem adipose cells, and bone marrow stem cells (Figure 3b). This analysis further highlighted the presence of proteins linked to stemness and regenerative potential across diverse tissue types in hTSC‐CM. Olink analysis revealed several proteins that were abundant in NCM and reduced in hTSC‐CM (blue), suggesting that they were eliminated or internalized by hTSCs, and several other proteins that were enriched in the hTSC secretome (red), suggesting that they were actively secreted or less internalized by hTSCs (Figure 3c, left); the latter group included proteins PTX3, MMP1, COL1A1, COL6A3, IL6, IL8, CXCL3, and VEGFA (Figure 3c, right; Table S3). Functional analysis of the hTSC secretome identified pathways such as growth factor activity, extracellular matrix, cytokine receptor binding, cytokine activity, signaling, and cell adhesion (Figure 3d). These pathways suggest that the hTSC‐CM can potentially play roles in cell growth and ECM remodeling.

To complement the Olink proteomic analysis, we performed protein array and Bio‐Plex analyses. The protein array analysis confirmed the enrichment of several key proteins, including PTX3, IL8, SERPINE1, and DKK1, in hTSC‐CM (Figure 3e). A longer exposure of the protein array (Figure S2a) indicated additional proteins in hTSC‐CM, such as IGFBP2, MCP‐1, MIF, BSG, and VEGFA. Interestingly, fibroblast growth factor 2 (FGF2) and platelet‐derived growth factor (PDGF) were less abundant in hTSC‐CM than in NCM (Figure 3e, Figure S2a), suggesting that these proteins were degraded or taken up by the cells. Bio‐Plex analysis (Figure 3f) indicated an enrichment of MMP3, CXCL1, and IL8 in the hTSC‐CM, while senescence‐associated secreted factors such as DPP4 and GPNMB remained unchanged, indicating selectivity in the protein composition in hTSC‐CM. A summary of proteins enriched in hTSC‐CM in the protein array and Bio‐Plex assays is presented in Figure S2b. Together, these results characterize the protein content of the hTSC‐CM secretome, highlighting protein profiles related to stemness and to potential roles in cell growth and tissue repair.

As described above, treatment with the hTSC‐derived secretome (CM), which includes both EVs and soluble non‐EV factors, led fibroblasts undergoing senescence to express reduced levels of SASP‐related mRNAs and to secrete lower concentrations of SASP factors. To dissect the specific contribution of hTSC‐EVs, we isolated EVs from the hTSC secretome using size exclusion chromatography (SEC). Fractions 7 to 13 were enriched in soluble proteins, as shown by the protein concentration peaks in the SEC chromatogram (Figure 4a), while fractions 2 to 4 were largely devoid of soluble proteins and instead contained EVs, as identified by their distinct elution profile (Figure 4b). These EV‐enriched fractions (fractions 2 to 4) were pooled, concentrated using a 3‐kDa cutoff filter, and analyzed for size distribution and particle concentration using NanoFCM, which confirmed particle sizes distributing mainly in the range of 50–150 nm, consistent with the sizes of small EVs such as exosomes (Figure 4c). The identity and morphology of the isolated hTSC‐EVs were confirmed using transmission electron microscopy (TEM), which identified spherical, membrane‐enclosed vesicles with diameters averaging ~80 nm, exhibiting a well‐defined lipid bilayer typical of EVs (Figure 4d). Further characterization of the surface markers of EV‐associated proteins using an ExoView instrument detected a robust presence of canonical EV markers CD63, CD81, and CD9 (Figure 4e). The negligible mIgG signal confirmed the specificity of the assay, while the low CD41a signal indicated minimal contamination from platelet‐derived particles (Figure S3a); individual marker channels revealed the heterogeneity in marker expression (Figure S3b). To assess EV uptake, WI‐38 fibroblasts were incubated for 24 h with PKH26‐labeled hTSC‐EVs; uptake was confirmed by intracellular fluorescence (Figure 4f).

To evaluate the functional impact of hTSC‐EVs on the SASP, WI‐38 fibroblasts were irradiated with 10 Gy and immediately afterwards they were incubated with hTSC‐EVs at a concentration of 10¹⁰ particles/mL (Day 1). EV treatment was refreshed once 48 h later (Day 3), as outlined in Figure 4g, and cells were harvested on Day 5 after IR to carry out RNA analysis. Phase‐contrast micrographs indicated that culture with hTSC‐EVs did not significantly alter cell morphology or density compared to untreated, irradiated control cells (Figure 4gbottom). However, RT‐qPCR analysis revealed a significant reduction in the levels of mRNAs encoding SASP factors, including IL8, GDF15, and CXCL1 mRNAs, in hTSC‐EV‐treated cells compared to controls (Figure 4h). These findings support the notion that hTSC‐EVs effectively reduce the levels of SASP‐associated mRNAs in recipient cells, suggesting a potential role in mitigating inflammation and tissue remodeling associated with cellular senescence.

For a more comprehensive understanding of hTSC‐EVs, we performed mass spectrometry (MS) analysis (MassIVE MSV000096320). The enrichment of stem cell‐derived proteins in the EVs was evaluated by the cell marker score; as shown in Figure 5a, the proteins present in hTSC‐EVs were scored as mesenchymal stem cells, trophoblasts, and placental stem cells, confirming that the hTSC‐EVs analyzed maintained their global stem cell features. The cellular components and structural functions of the proteins identified in the hTSC‐EVs were then examined. GO analysis revealed that these proteins are associated with extracellular organelles, vesicles, and exosomes (Figure 5b), and they are also associated with focal adhesions, cell‐substrate junctions, and anchoring junctions, which are critical for cell adhesion and communication with the surrounding ECM (Figure 5b). Regarding molecular functions, hTSC‐EV proteins were enriched in extracellular matrix structural constituents, suggesting roles in ECM maintenance and stability (Figure 5c). MS analysis further identified a range of collagen types and ECM‐related proteins, such as Collagen alpha‐3(VI) chain, MMP2, Thrombospondin‐1 (TSP1), and Agrin (Figure 5d, Table S4).

Next, we integrated data from the Olink and mass spectrometry (MS) analyses to identify proteins present in both the EV and non‐EV fractions of the hTSC secretome, and we examined their relevance to cellular senescence. Interestingly, we found 148 proteins enriched in the hTSC secretome (Figure 5e, Table S5) that were previously reported to be downregulated in senescent cells (Munk et al. 2021), including Lamin B1 (LMNB1) and Heterogeneous nuclear ribonucleoprotein C (HNRNPC), which play roles in nuclear structure and RNA processing, respectively. These findings suggest that hTSC‐EVs contain proteomes rich in stem cell‐ and ECM‐related factors and may potentially restore proteins that are lost or reduced in senescent cells.

In senescence, DNA damage (as triggered by IR or Eto) is tightly interconnected with signaling leading to the activation of the transcription factor NF‐κB, which in turn amplifies the SASP. We thus hypothesized that hTSC‐CM and EVs may broadly impact senescence by interfering with NF‐κB activation.

To assess DNA damage in WI‐38 cells after IR, we performed the Comet assay, which measures the extent of unrepaired DNA in the form of fast‐migrating tails (comets). In IR‐treated cells that were incubated with NCM, comets showed longer and brighter tails, indicating higher levels of DNA damage. In contrast, IR‐treated cells that were incubated with hTSC‐CM showed shorter, less intense tails, suggesting reduced DNA damage (Figure 6a). Following IR treatment of WI‐38 cells, incubation with NCM led to higher levels of phospho (γ)H2AX (a marker of DNA damage) and phospho (p)NF‐κB (a marker of NF‐κB activation) compared to the levels in WI‐38 cells incubated with hTSC‐CM or EVs, which exhibited lower γH2AX and p‐NF‐κB signals, suggesting reduced DNA damage and reduced NF‐κB activation (Figure 6b). Similarly, treatments with hTSC‐EVs revealed decreased γH2AX and p‐NF‐κB in senescent WI‐38 cells (Figure 6c). These findings indicate that hTSC‐CM and hTSC‐EVs suppress or repair DNA damage and suppress NF‐κB activation, culminating in decreased SASP factor production (Figures 2, 4, and 6b,c).

Human WI‐38 diploid fibroblasts (Coriell Institute for Medical Research: ID AG06814) were grown in Dulbecco's Modified Eagle Medium (DMEM) supplemented with 10% fetal bovine serum (FBS), 1% non‐essential amino acids, and 1% antibiotics (Gibco). Cells were maintained at 37°C in a humidified atmosphere with 5% CO₂ and routinely tested negative for mycoplasma. Proliferating WI‐38 fibroblasts (between PDLs 22 and 24) were treated with a single IR dose (10 Gy) on Day 1, and the medium was immediately supplemented with either NCM or hTSC‐CM. On Day 3, the medium was replaced and fresh NCM or hTSC‐CM was added until harvest on Day 5. Etoposide (Eto) treatment (50 μM) started on Day 1 together with NCM or hTSC‐CM, and continued until Day 3, when the medium was replaced with fresh Eto and supplemented with fresh NCM or hTSC‐CM. All samples were collected on Day 5 to assess the impact of hTSC‐CM (relative to NCM) on cells exposed to a senescence trigger (Figure 1c). Senescence‐associated β‐galactosidase (SA‐β‐Gal) activity, a widely used biomarker of senescent cells in culture and in tissues, detects lysosomal β‐galactosidase activity at pH 6.0; this activity is specifically elevated in senescent cells due to the increase in lysosomal mass and function that accompanies the senescent phenotype. The pH‐dependent detection distinguishes senescent cells from proliferating cells, as normal lysosomal β‐galactosidase activity is optimal at pH 4.0. SA‐β‐Gal activity was detected as described (Abdelmohsen et al. 2024), following the manufacturer protocol (Cell Signaling Technology, cat. #9860). Images of SA‐β‐Gal staining were acquired using a Nikon Digital Sight camera system attached to a Nikon Eclipse TS100 microscope.

Human trophoblast stem cells ABX‐001 hTSC 2003 were originally derived from chorionic villi obtained during salpingectomy/salpingotomy procedures for ectopic pregnancy early in gestation. Tissue procurement, derivation, and banking were performed under IRB‐approved protocols (KMUHIRB‐F(I)‐20200184) and ethics review by the Stanford Center for Biomedical Ethics (available upon request). Cells were cultured in conditioned media (MesenCult, Stemcell Technologies, Cat#05446) at Accelerated Bioscience with confirmed mycoplasma‐free and pathogen‐free status, demonstrating post‐thaw viabilities of approximately 97%–98%. The morphology of hTSC cells was documented by imaging in adherent culture using a Keyence (BZ‐X710) phase‐contrast microscope equipped with a 4× objective.

The presence of surface markers in hTSCs was evaluated by flow cytometry using a CytoFLEX flow cytometer (Beckman Coulter). Cells were harvested, counted, and stained for 30 min with either PE‐conjugated primary antibodies recognizing CD45, CD90, and CD105 (R&D Systems) or corresponding isotype controls (R&D Systems; 500,000 cells/sample). Data analysis and measurement of percentages of positive and negative cells was performed using the FlowJo software (BD).

Conditioned medium from passages 1 to 11 was collected from hTSC cultures to test its impact on cellular senescence. Additionally, EVs were isolated from the conditioned media to evaluate their effects on senescence phenotypes. For the control non‐conditioned media (NCM), MesenCult was used directly as supplied by the manufacturer, without culture of any cells. All media handling was performed in a sterile cell culture environment, followed by centrifugation to remove cellular components and debris. Cell culture media were concentrated from 200 mL to 10 mL using a 3‐kDa molecular weight cutoff filter (Amicon Ultra‐15, UFC900308) by centrifugation at 3000 RPM for 1 h at 4°C; after it was concentrated 20×, the medium was stored at −80°C until use. WI‐38 cells were incubated with a final 2× secretome immediately following IR treatment or concurrently with Eto treatment; the media were refreshed including Eto at regular intervals as shown in Figure 1c. Similarly, WI‐38 cells were incubated with the hTSC‐EVs immediately following IR treatment and the media were refreshed with EVs on Day 3 as shown in Figure 4g.

EVs were isolated from the concentrated hTSC‐CM (secretome, as explained above) using qEV10, 35‐nm SEC columns (IZON Science), according to the manufacturer protocol. Briefly, 10 mL of secretome concentrate was loaded onto the column, after which 13 fractions (5 mL each) were collected to assess EV and protein distribution. Typically, the first 2 to 4 fractions contained EVs, which were then concentrated using a 3‐kDa molecular weight cutoff filter. The size and distribution of the concentrated EV sample were subsequently assessed using a NanoFCM instrument. Cells were treated with EVs (~10⁹ particles/mL) in 24‐well plates.

EVs were labeled with the red fluorescent lipid dye PKH26 (Sigma‐Aldrich, St. Louis, MO) with modifications to minimize dye micelle formation. Briefly, 100 μL of EVs (10¹⁰ EVs/mL) were mixed with 0.2 μM PKH26 solution in diluent C (Sigma‐Aldrich) and incubated for 1 min at room temperature. As a control, 100 μL of PBS alone were subjected to the same PKH26 staining procedure to assess potential micelle formation. After labeling, 100 μL of PBS were added to the EV solution, and the free dye was removed using a Zeba Spin Desalting Column (7K MWCO, Thermo Fisher Scientific, cat. # 89892). To assess EV uptake, WI‐38 cells were incubated with PKH26‐labeled hTSC‐EVs for 24 h at 37°C and 5% CO₂. Following incubation, cells were washed twice with PBS to remove unbound EVs and fixed with 3% formaldehyde in PBS for 10 min at RT. After fixation, cells were permeabilized with 0.1% Triton X‐100 (Sigma‐Aldrich) in PBS for 5 min at room temperature, then washed 3× with DPBS to remove residual Triton X‐100. To visualize nuclei, cells were stained with DAPI and fluorescent images were captured using a Keyence microscope.

The size distribution of the isolated EVs was analyzed using nanoflow cytometry (NFCM) as previously described (Abdelmohsen et al. 2023) with the Flow NanoAnalyzer (NanoFCM Inc.). Briefly, the instrument was calibrated using 250‐nm Silica Beads to establish particle concentration and a Silica Nanosphere Cocktail to determine particle size. Particle concentration and size were measured based on the calibration curve, flow rate, and side scatter intensity, with data acquisition performed for 1 min per sample, following the manufacturer guidelines for NanoFCM operation.

Surface marker proteins on EVs were analyzed using the ExoView R200 platform (NanoView Biosciences) as described (Abdelmohsen et al. 2023). Briefly, 50 μL of EV samples at equal concentrations were incubated on ExoView Tetraspanin chips in a 24‐well plate for 16 h. Following incubation, the chips were washed three times with 1× Solution A before adding 250 μL of detection antibodies in blocking buffer for 1 h. Subsequent washing steps included two washes with Solution A, three washes with Solution B, and a final rinse with deionized water. After drying on absorbent paper, the chips were scanned using the ExoView R200 system and analyzed with ExoScan software (NanoView Biosciences).

For transmission electron microscopy (TEM) imaging analysis (Johns Hopkins University EM facility), 20 μL of EV samples (approximately 10¹⁰ particles/mL) were placed onto carbon‐coated parlodion copper grids and allowed to adhere for 2 min. The grids were then floated sequentially on two drops of filtered 0.75% uranyl acetate aqueous solution containing 0.03% tylose for 1 min each, followed by blotting with filter paper for adsorption. EVs were immobilized on poly‐L‐lysine‐coated coverslips using a fixation solution of 1% glutaraldehyde in 80 mM phosphate buffer with 5 mM MgCl₂. Coverslips were subsequently rinsed with sucrose‐containing buffer and post‐fixed in osmium tetroxide reduced with potassium ferrocyanide for 1 h on ice.

To improve visualization, en bloc staining was applied using a 2% uranyl acetate solution in maleate buffer for 1 h. The EV samples were then dehydrated through a sequence of ethanol solutions (ranging from 30% to 100%), then embedded in Eponate 12 resin, and hardened by heating at 60°C for 48 h. Coverslips were subsequently mounted onto inverted beam capsules and immersed in liquid nitrogen for 10 min, then detached from the capsules. The solidified resin blocks were trimmed and ultrathin sections (50–60 nm) were obtained using a Reichert Ultracut E ultramicrotome equipped with a Diatome diamond knife. Sections were stained with methanolic uranyl acetate, followed by lead citrate incubation. Between staining steps, thorough rinsing was performed with distilled water. Coverslips were fixed in 2% glutaraldehyde in 100 mM sodium cacodylate buffer and stained with 2% uranyl acetate for 20 min and periodically rinsed with distilled water. Finally, imaging was performed on a Hitachi H‐7600 TEM operated at 80 kV. Digital images were acquired using an XR50 5‐megapixel CCD camera from Advanced Microscopy Techniques Corp.

For mass spectrometry (MS) analysis, proteins were extracted from the isolated EVs, and protein concentrations were determined using the Pierce MicroBCA kit. Samples were processed by treating with DTT for reduction, subsequently with iodoacetamide for alkylation, and finally digested with trypsin in a 25 mM NH₄HCO₃ solution. The resulting tryptic peptides were purified using a C18 column before being reconstituted in 25 μL of 0.1% formic acid; 12 μL of this mixture was analyzed by liquid chromatography‐tandem mass spectrometry (LC‐MS/MS) at 110‐min run time (Thermo Scientific Orbitrap Exploris 240 Mass Spectrometer and a Thermo Dionex UltiMate 3000 RSLCnano System). The Orbitrap Exploris 240 operated in a data‐dependent mode, alternating between full‐scan MS and MS/MS acquisition. Peptide mixtures were loaded onto a peptide trap cartridge at a flow rate of 5 μL/min before being transferred onto a Thermo Fisher Scientific EasySpray C18 column via a linear gradient of 3%–36% acetonitrile in 0.1% formic acid over 110 min at a flow rate of 0.3 μL/min. Ionization was performed using a Nano‐EasySpray Ion Source with a spray voltage of 1.6 kV and a capillary temperature of 275°C. Eluted peptides were ionized and sprayed into the mass spectrometer using a Nano‐EasySpray Ion Source (Thermo Fisher Scientific) with spray voltage of 1.6 kV and capillary temperature of 275°C. The instrument was set to isolate and fragment the 15 most intense multiply charged ions (z ≥ 2) using higher‐energy collisional dissociation (HCD) with a normalized collision energy of 30. The AGC target was adjusted to 10⁵, with a maximum injection time of 200 ms and a resolution of 17,500. The isolation window was set to 2, and a dynamic exclusion of 20 s was applied to minimize redundant fragmentation. Charge state screening was enabled to exclude unassigned ions and those with a charge state of 1+ or ≥ 7+. To ensure specificity, the same steps were performed using MesenCult (Stemcell Technologies, Cat#05445) as a negative control. Raw data files were processed using Proteome Discoverer (v1.4) and analyzed via the SEQUEST algorithm (Thermo Fisher Scientific). The acquired spectra were searched against protein sequence database from UniProtKB/Swiss‐Prot. Peptide filtering criteria included a minimum sequence length of five amino acids and a maximum false discovery rate (FDR) threshold of 0.01. Assembled proteins with peptide spectrum match (PSM) counts were quantified and normalized using the normalized spectral abundance factors (NSAFs) to determine their relative abundance. Raw files are available in MSV000096320 [doi: 10.25345/C5QR4P30R↗].

To extract total protein, cells were rinsed twice in 1× PBS before lysis in a 2% SDS buffer containing 50 mM HEPES and freshly prepared protease/phosphatase inhibitors (Cell Signaling Technology). Protein concentration was quantified with the BCA assay kit (Pierce). The lysates were mixed with 4× SDS Laemmli buffer (Bio‐Rad) supplemented with β‐mercaptoethanol and heated at 95°C for 5 min to denature proteins. For western blot analysis, protein samples were loaded onto Tris‐Glycine gels (Bio‐Rad), separated by SDS‐PAGE, and transferred to nitrocellulose membranes using the iBlot kit (Invitrogen). Membranes were blocked for 1 h at room temperature with 5% nonfat milk in 1× TBST, followed by overnight incubation at 4°C with primary antibodies. Primary antibodies were used that recognized phospho‐Histone H2AX Ser139 (γH2AX) (#9718), phospho‐NF‐κB p65 Ser536 (#3033), and NF‐κB p65 (#8242) (all from Cell Signaling Technology), as well as β‐actin (ACTB) (sc‐8432, Santa Cruz Biotechnology). The membranes were then washed in 1× TBST and incubated with secondary antibodies in 5% nonfat milk for 1 h at room temperature. After washing, membranes were treated with ECL solution (Kindle Biosciences), and chemiluminescent signals were detected using a ChemiDoc imaging system (Bio‐Rad).

Total RNA was extracted from cells using TRIzol reagent (Thermo Fisher Scientific) following the manufacturer's protocol. RNA concentration was assessed using a NanoDrop spectrophotometer (Thermo Fisher Scientific). Reverse transcription (RT) was carried out using 500 ng of total RNA with the Maxima Reverse Transcriptase protocol (Thermo Fisher Scientific) and transcript levels analyzed via quantitative real‐time PCR (qPCR) using the SYBR Green FAST qPCR master mix kit (Kapa Biosystems) on a QuantStudio 5 Real‐Time PCR System (Thermo Fisher Scientific). For qPCR amplification, these specific primer pairs were employed: CAACCAGAGCTGGGAAGATTCG and CCCGAGAGATACGCAGGTGCA for GDF15, GAAAGAGTGGCAACCTGCCTTC and GCACCAAGTTTTACTACATCTGCC for MKI67, GTCTCCGGGAATCTCTGATGC and GTTCAGTGGAGCCCAGCTCT for BAFF, AGTGAGGAACAAGCCAGAGC and GTCAGGGGTGGTTATTGCAT for IL6, AGCTTGCCTCAATCCTGCATCC and TCCTTCAGGAACAGCCACCAGT for CXCL1, TCCTGATTTCTGCAGCTCTGT and AAATTTGGGGTGGAAAGGTT for IL8, and CATGTACGTTGCTATCCAGGC and CTCCTTAATGTCACGCACGAT for ACTB mRNA. RNA levels were calculated with the 2^−ΔΔCt method and were normalized to GAPDH mRNA levels.

RNA‐Sequencing (RNA‐seq) was conducted on total RNA extracted from WI‐38 recipient cells treated as described in Figure 1a. RNA integrity was evaluated using an Agilent Bioanalyzer, and libraries were generated and sequenced by Azenta Life Sciences. Raw sequencing reads were processed, aligned to the human genome (GRCh38), and subjected to differential expression analysis using DESeq2. Raw sequencing data are available under accession GSE282054.

The levels of secreted cytokines in the hTSC conditioned media (CM) or non‐conditioned media (NCM) were assessed using the Human Cytokine Antibody Array (R&D Systems) following the manufacturer protocol, and chemiluminescent signals were captured using a ChemiDoc imaging system (Bio‐Rad).

For multiplex cytokine analysis, the hTSC‐CM or NCM were analyzed using human Luminex Assay kits (R&D Systems) to quantify DPP4, IL8, IL6, GDF15, MMP3, Osteopontin, GM‐CSF, and ICAM1, with media diluted 1:10 in Calibrator Diluent RD6‐52. Standards, blanks, and diluted media were incubated with the microparticle cocktail for 2 h at 25°C, followed by incubation with the Biotin‐Antibody cocktail for 1 h and a final 30‐min incubation with Streptavidin‐PE under shaking conditions at 25°C. Each incubation step was followed by three washes with Wash Buffer, and the plate was analyzed using the Bio‐Rad Bioplex‐200 Instrument with the following settings: 50 μL sample volume, Bio‐Plex MagPlex Beads (Magnetic), Double Discriminator Gates set at 8000–23,000, low RP1 target value for the CAL2 setting, and a bead count of 50 per region. Results were processed and analyzed using Bio‐Plex Manager software (Bio‐Rad).

For Olink proteomic analysis, we used the media to evaluate the secretome of the hTSCs or WI‐38 cells at Indiana University. Briefly, target proteins were detected through a highly specific binding interaction with dual oligonucleotide‐labeled antibody probes. The bound probes underwent microfluidic real‐time PCR amplification, enabling the quantitative detection of the corresponding DNA sequences. Internal and external controls were utilized for quality control and normalization. Normalized Protein expression (NPX) values were provided as the final assay readout corresponding to protein levels.