What this is
- This research investigates the effects of on glucose and lipid metabolism in obese mice.
- activates () and induces ().
- The study measures changes in body weight, food intake, glucose tolerance, and lipid profiles after treatment.
Essence
- reduces body weight and improves glucose and lipid metabolism in obese mice by activating and promoting browning.
Key takeaways
- treatment decreased body weight in high fat diet (HFD) mice by 13.0% to 15.7% over 6 weeks at 40 mg/kg and by 11.1% to 13.9% at 80 mg/kg. This indicates its potential to combat obesity.
- improved glucose tolerance, reducing the area under the curve (AUC) by 31.1% to 45.1% compared to HFD mice. This suggests enhanced metabolic function.
- treatment significantly increased the expression of thermogenic proteins UCP1 and prohibitin in both scWAT and , indicating enhanced energy expenditure and metabolic activity.
Caveats
- The study is limited to animal models, which may not fully translate to human physiology.
- Long-term effects and safety of treatment in humans remain to be established.
Definitions
- Emodin: A natural anthraquinone derivative with various pharmacological effects, including lipid-lowering and glucose-regulating properties.
- Brown Adipose Tissue (BAT): A type of fat tissue specialized for energy expenditure and heat production.
- Browning of White Adipose Tissue (WAT): The process by which white fat cells acquire characteristics of brown fat cells, enhancing their metabolic activity.
AI simplified
Background
White adipose tissue (WAT) and brown adipose tissue (BAT) play a critical role in modulating energy metabolism (1). The adipocytes within WAT store large amounts of triglycerides as chemical energy in unilocular droplets, which are released into circulation as needed. WAT also functions to produce hormones and cytokines, regulates immune system and supports local tissue frame (2). Increases in WAT mass are directly associated with increased rates of metabolic diseases such as obesity and type 2 diabetes (3). BAT is specialized for energy expenditure, which is characterized by small multi-atrial lipid droplets, abundant mitochondria and expresses uncoupling protein 1 (UCP1) (4, 5). BAT dissipates energy as heat and stores energy for use of non-shivering thermogenesis, which also plays a significant role in energy regulation (5, 6). It has been confirmed that when the body is stimulated by cold exposure (7) or activated by Ī²-adrenoceptors agonist (8), brown-like phenotypic adipocytes (e.g. beige adipocytes) can be detected in WAT, which are characterized by an increased number of mitochondria and increased expression of brown fat marker genes (e.g. Ucp1, Pgc-1Ī±, Prdm16). The above process is called browning of WAT. Recent studies showed that increasing metabolic activity of brown and beige adipose tissue might be a novel way to ameliorate glucose and lipid metabolism in obese patients (9ā12). Furthermore, changes in tissue lipid content reflects selective remodeling in scWAT and BAT of both phospholipids and glycerol lipids in response to specific conditions such as exercise training (1).
Emodin (1,3,8-trihydroxy-6-methylanthraquinone) is a natural anthraquinone derivative, and is the main component of Rheum palmatum L (13). It has been reported to exhibit anti-inflammatory, anti-bacterial, anti-cancer, anti-diabetic, anti-ulcerogenic, immunosuppressive, pro-apoptotic and chemopreventive activities (14ā18). It has been found that the emodin can regulate glucose utilization and lower lipids in epididymal WAT by activating AMP activated protein kinase (AMPK) pathway (19, 20). In addition, the emodin could inhibit adipocyte differentiation and enhances osteoblast differentiation from bone marrow mesenchymal stem cells (BMSCs) (21). And it could improve the inactive glucocorticoid-induced adipose tissue dysfunction by selective inhibition on 11Ī²-hydroxysteroid dehydrogenase type 1 (11Ī²-HSD1) in 3T3-L1 adipocyte (22). Our previous research also showed that emodin could inhibit the accumulation of white adipocytes and inducing browning of WAT in apolipoprotein E knockout (ApoE-/-) mice (23). However, the effect of emodin on the lipid metabolic signature of scWAT and BAT has not been investigated. Here, we report the effect of emodin on adipose tissue in high fat diet-induced obese mice, as well as a comprehensive analysis of lipid composition in scWAT and BAT.
Materials and Methods
Chemicals and Reagents
Emodin (purity 95%) was purchased from Shanghai Yuanye Biotechnology Co., Ltd. CL 316243 disodium salt was purchased from APExBIO Technology LLC (Houston, USA). Biochemical kits of serum total cholesterol (TC), triglyceride (TG), high-density lipoprotein cholesterol (HDL-c), and low-density lipoprotein cholesterol (LDL-c) were purchased from Nanjing Jiancheng Bioengineering Institute (Nanjing, China). Free fatty acid (FFA) ELISA assay kit was purchased from Jiangsu Kete Biotechnology Co., Ltd. (Jiangsu, China). Leptin ELISA assay kit and adiponectin ELISA assay kit were purchased from cloud-clone Corp. Wuhan (Wuhan, China).
Animals and Experimental Protocol
Eight-week-old male C57BL/6J mice weighing 18-22g were purchased from Sibeifu (Beijing) Biotechnology Co., Ltd (grade SPF, Certificate No: SCXK (jing) 2016-0002). Mice were maintained at 23 Ā± 1Ā°C and 60-70% humidity with a 12h light/dark cycle. The regular diet was a standard chow diet containing 3.65 kcal/g. And the high fat diet was 60% of kilocalories from fat containing 5.24 kcal/g. Normal diet is purchased from SBF (Beijing) Biotechnology Co., Ltd (Beijing, China, 0817SH08200438C). High fat diet was purchased from Beijing huafukang Biotechnology Co., Ltd (Beijing, China, 20180376).
Mice were randomly divided into two groups according to weight and fed with normal control diet (n=8) or fed with high fat diet (HFD) for 8 weeks to induce hyperlipidemia. After 8 weeks of HFD, mice were randomly divided into four groups as follows (n=8/group): HFD group, emodin 40 mg/kg group, and emodin 80 mg/kg group, and CL 316243 1 mg/kg group. Mice in normal control group and HFD group were administrated with equal amount of 0.1% carboxymethyl cellulose-Na (CMC-Na). Mice in emodin 40 and 80 mg/kg groups were taken emodin (dissolved in 0.1% CMC-Na) by intragastric administration for consecutive 6 weeks. Before dissection, mice in CL 316243 1 mg/kg treatment group were intraperitoneally injected with 1mg/kg/day of CL 316243 disodium salt for 3 days. All the animal studies were in accordance with ethics standards of the Animal Care and Welfare Committee of Beijing University of Chinese Medicine (Certificate No. BUCM-04-2018070603-3015).
Oral Glucose Tolerance Test
After 6 weeks of intervention, the mice were fed by oral gavage with 50% D-glucose (2.0 g/kg) after overnight (12Ā h) fasting. Blood samples were taken from the tail 0, 30, 60, 90 and 120Ā min after oral gavage, and glucose levels were measured by the One Touch Ultra blood glucose monitoring system (ONETOUCH Ultra Easy).
Measurement of Leeās Index
At the end of the treatment, the body mass of the mice was accurately weighed, and the body length (the distance from the tip of the nose to the anus) was accurately measured, and then the Leeās index was calculated according to the reference (24).
Measurement of Adipose Tissue Mass/Body Weights
Subcutaneous WAT (scWAT) mass and scapular brown adipose tissues (BAT) mass were accurately weighed. The ratios of scWAT mass to body weight (BW) and BAT mass to body weight (BW) were calculated.
Serum Biochemical Analysis
Serum TC, TG, HDL-c and LDL-c levels were measured with the method of biochemical kits (Nanjing Jiancheng, China). The levels of FFA were determined by the Mouse FFA ELISA kit (Kete, China). Serum leptin and adiponectin levels were analyzed using the mouse leptin and adiponectin ELISA kit respectively (Cloud-clone, China).
Histological and Immunohistochemical Analysis
BAT and scWAT were fixed with 10% formalin, dehydrated, embedded in paraffin and sectioned. For histological analysis, sections were deparaffinized and stained with hematoxylin and eosin. The expression of UCP1 (1:500, ab10983, Abcam) and prohibitin (1:500, ab75766, Abcam) in mouse BAT and scWAT was determined by immunohistochemistry. All images were acquired with the microscope (Leica, Germany). The expression level of UCP1 and prohibitin in BAT and scWAT of the mice was quantified by using Image Pro Plus 6.0.
Quantitative Real-Time PCR Analysis
Total RNA of scWAT was extracted with TrizolĀ® Reagent (Ambion, USA). Reverse transcription of total RNA (1 Ī¼g) was performed with Revert Aid First Stand cDNA Synthesis Kit (Thermo Scientific, USA). Real-time quantitative PCR (qRT-PCR) was performed with a SYBR Green Master Mix (Novoprotein, China). The PCR reaction was operated in triplicate for each sample using the Step One Real-Time PCR System (Applied Biosystems, USA). After standardizing the expression level of internal control actin in each sample, the data were expressed in arbitrary units. The sequences of primer in this study were shown in Table 1.
| Gene name | Forward (5ā-3ā) | Reverse (5ā-3ā) |
|---|---|---|
| Cd137 | GGTGGACAGCCGAACTGTAA | GCTGCTCCAGTGGTCTTCTT |
| Tmem26 | AGTGTGAGCAAGAACTCGGG | GATGGCCGGAGAAAGCCATT |
| Tbx1 | CGCTACCGGTATGCTTTCCA | GTCTTTTCGAGGGGCCACAT |
| Ī²-actin | GGTGGGAATGGGTCAGAAGG | GTTGGCCTTAGGGTTCAGGG |
Western Blot Analysis
The homogenates of scWAT and BAT were dissolved in RIPA lysate and protease inhibition for protein extraction. Sample protein concentrations were measured using the bicinchoninic acid (BCA) method (Beyotime). Total protein (10Ī¼g/Lane) was separated on a 12% acrylamide/acrylamide gel using sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and transferred to polyvinylidene difluoride (PVDF) membranes. PVDF membranes containing protein were incubated with specific anti-alpha tubulin antibody (1:5000, ab18251, Abcam), anti-UCP1 antibody (1:1000, ab10983, Abcam), anti-Prohibitin antibody (1:10000, ab75766, Abcam), anti-PPAR Ī± antibody (1:2000, ab8934, Abcam), anti-CD36 antibody (1:5000, ab133625, Abcam), anti-slc27a4/FATP4 antibody (1:1000, ab200353, Abcam), respectively. Then membranes were incubated with HRP-conjugated Affinipure Goat Anti-Mouse IgG (H+L) (1:5000, 20000175, proteintech) or HRP-conjugated Affinipure Goat Anti-Rabbit IgG (H+L) (1:5000, 20000174, proteintech). Protein bands were visualized using the ECL kit (EMD millipore). Image was analyzed using Image-Pro-Plus 6.0.
Targeted Lipidomics Analysis
Tissue Sample Preparation
BAT and scWAT tissue samples were thawed on ice. Samples were accurately weighed and then homogenized in the 1.5 mL centrifuge tube using a Speed Mill Plus. Internal standards were dissolved in 300Ī¼L of methanol [SPLASHĀ® II LIPIDOMIXĀ® Mass Spec Standard (330709), Cer/Sph Mixture I (LM6002, Avanti), 12:0-13:0 PC (LM1000, Avanti), 12:0-13:0 PE (LM1100, Avanti)] and added to each sample, and then extracted with 1mL of methyl tert-butyl ether (MTBE) for 1 hour. The extraction was added 250 Ī¼L of water and pelleted in a 4Ā°C centrifuge at 12,000 rpm for 5 min. 100 Ī¼L of the MTBE layer was transferred to a new 1.5 mL centrifuge tube and dried in a Savantā¢ SpeedVacā¢ High Capacity Concentrator. The dried sample was reconstituted with 400 Ī¼L of isopropanol/acetonitrile (1:1) and shaken for 40s. And the dissolved matter was centrifuged at 12,000 for 5 min, and then 100 Ī¼L of the supernatant was transferred to a 200 Ī¼L vial insert for liquid chromatography-mass spectrometry analysis.
Chromatography
ACQUITY Ultra Performance Liquid Chromatography (UPLC) I-Class System (Waters, USA) with ACQUITY UPLC BEH C8 Column (2.1 mmĆ100 mm, 1.7 Ī¼m) was used to perform the UPLC separation. For C8 separation, mobile phase A is acetonitrile/water (60/40) and mobile phase B is acetonitrile/isopropanol (90/10), and both A and B contain 0.1% formic acid and 5 mM ammonium acetate (formate). The gradient conditions were shown in Tables 2 and 3.
Quality Control
Five QC samples of adipose tissue were continuously injected at the beginning of the sequence to monitor the UPLC-MS system stability by the Overlay Graphs method using Mass Lynx software. And QC samples were run at regular intervals (8 samples) throughout the entire sequence.
Mass Spectrometry
Electrospray ionization tandem mass spectrometry (XEVO TQ-S Micro, Waters, USA) was used for mass spectrometry. And the conduct conditions of ESI+ and ESIā showed in Table 4. Masslyxn4.1 was used for mass spectrometry data acquisition.
| Parameter | ESI+ | ESI- |
|---|---|---|
| Capillary voltage | 3200V | 2000V |
| Desolvation temperature | 500Ā°C | 500ā |
| Source temperature | 120Ā°C | 120ā |
| Desolvation gas flow | 1000 L/h | 1000L/h |
| Cone gas flow | 150 L/h | 150 L/h |
| Nebuliser gas | 7.0 bar | 7.0 bar |
| Collision gas flow | 0.13 L/h | 0.13 L/h |
Statistical Analysis
The data of target metabolism group were operated by skyline 19.1. The parameters were set as follows: the quality extraction error was 5 ppm and the allowable retention time error was 15s. Other data were statistically analyzed using SAS 8.2 software. All data were expressed as means Ā± SE. Two-way analysis of variance for repeated measures was used for body weight analysis (for the effects of treatment and time). Other statistics was performed using the one-way analysis of variance (ANOVA) followed by SNK-q test. P-value<0.05 was considered as statistically significant.
Results
Emodin Can Inhibit Obesity and Appetite and Reduce Fat Mass in HFD Induced Obese Mice
The HFD treated mice showed characteristics of obesity. When compared with the control mice, parameters including body weight, food intake, Leeās index and scWAT/BW ratio were significantly increased in HFD treated mice (by 51.6%, 41.1%, 8.5% and 39.1%, respectively). Emodin at the dose of 40 mg/kg caused a significant reduction in body weight at week 5 and 6 (by 13.0% and 15.7%, respectively), and emodin 80 mg/kg caused a remarkable reduction in body weight at week 3, 4, 5, 6 (by 11.1%, 12.6%, 12.6% and 13.9%, respectively), when compared with HFD mice (Figure 1A).
Emodin (40 mg/kg, 80 mg/kg) significantly decreased the food intake by 9.8% and 7.3%, respectively, when compared with the obese mice (P <0.01 or P <0.05) (Figure 1B).
Leeās index can be used as an indicator to evaluate the degree of obesity in adult obese model mice (25). Emodin at the doses of 40 and 80 mg/kg and CL316243ā (1 mg/kg) treatment group could significantly reduce the Leeās index, when compared with HFD mice (P <0.01) (Figure 1C).
The ratio of scWAT to BW in mice treated with emodin (40mg/kg, 80mg/kg) and CL316243ā (1mg/kg) was significantly decreased (by 39.1%, 46.4% and 40.9%, respectively), when compared with the HFD mice (P < 0.01 or P < 0.05). (Figure 1D).
The function of BAT is consuming glucose and lipids, mediating the thermogenic effects of non-shivering, thereby increasing energy expenditure (26). Interestingly, compared with HFD mice, emodin (80 mg/kg) and CL 316243 (1 mg/kg) treatment significantly decreased the ratio of BAT/BW (by 22.5% and 47.5%, respectively (Figure 1E).
Effects of emodin on body weight, food intake and Leeās index in HFD mice. Mice were fed with high fat diet (HFD) containing 5.24 kcal/g for 8 weeks to induce hyperlipidemia. The mice in HFD+Emo group were intragastrically administered with emodin at the doses of 40 and 80 mg/kg/day respectively for consecutive 6 weeks. The mice in HFD+CL 316243 group were intraperitoneally injected with 1mg/kg/day of CL 316243 disodium salt for 3 days just before detecting time point.Body weight.Food intake.Leeās index.The ratio of scWAT mass/BW.The ratio of BAT mass/BW. HFD, high fat diet; Emo, emodin. Data are expressed as mean Ā± SE, with= 8.< 0.05,< 0.01HFD group. (A) (B) (C) (D) (E) n P P vs. * **
Emodin Ameliorates Abnormal Blood Glucose and Blood Lipid in Mice Fed With HFD
In this study, we investigated whether emodin improved glucose tolerance in obese mice. The results indicated an impaired glucose tolerance in HFD mice, and high fat diet significantly increased AUC index, when compared with control mice (P <0.01). Emodin at the doses of 40 and 80 mg/kg and CL316243ā (1 mg/kg) treatment significantly decreased AUC value (31.1%, 35.3% and 45.1% respectively), when compared with HFD mice (P <0.01) (Figures 2A, B). These results suggested that emodin could ameliorate glucose metabolism in obese mice.
To investigate whether emodin improved hyperlipidemia in obese mice, blood lipid parameters were measured. When compared with control mice, serum TC, TG, LDL-c, HDL-c and FFA levels were significantly increased in obese mice (P <0.01). When compared with obese mice, emodin (40 mg/kg, 80 mg/kg) could remarkably decrease serum TC, TG and LDL-c by 15.1%-16.3%, 19.6%-34.0%, 52.9%-54.3%, respectively (P <0.01 or P <0.05) (Figures 2CāE), and emodin (80 mg/kg) could remarkably decrease serum FFA levels (Figure 2G), but there was no significant difference in the content of HDL in serum (Figure 2F).
Leptin plays an important role in maintaining energy metabolism and regulating adipose ratio (27). It was demonstrated that the serum leptin content of HFD mice was significantly increased by 574.3%, when compared with control mice (P <0.01). Emodin (40 mg/kg, 80 mg/kg) and CL316243ā (1 mg/kg) caused significant reduction in leptin levels (by 40.7%, 54.6% and 41.5%, respectively), when compared with HFD mice (P <0.01) (Figure 2H).
As an endogenous insulin sensitizer secreted by adipose tissue, reduction of adiponectin is an independent risk factor for hyperlipidemia and diabetes (28). When compared with control mice, serum adiponectin in HFD mice was significantly decreased (P <0.01). Emodin (40 mg/kg, 80 mg/kg) treatment could significantly increase the serum adiponectin levels in HFD mice (by 28.6% and 42.9%, respectively), when compared with HFD mice (P <0.01 or P <0.05) (Figure 2I).
Effects of emodin on blood glucose and lipids in HFD mice.Oral glucose tolerance test (OGTT). The mice were fasted for 12Ā h, and then 2 g/kg glucose was given oral gavage. Glucose levels were tested before (0) and after fed glucose at 30, 60, 90, and 120Ā min.Quantification of AUC from the OGTT.Serum TC, TG, LDL-c, HDL-c concentration.Serum free fatty acids concentration.Serum leptin concentration.Serum adiponectin concentration. HFD, high fat diet; Emo, emodin. Data are expressed as mean Ā± SE, with n = 8.< 0.05,< 0.01HFD group. (A) (B) (CāF) (G) (H) (I) * ** P P vs.
Emodin Induces Browning of scWAT in Mice Fed With HFD
We analyzed the morphology of scWAT and the expression of thermogenic protein UCP1 and mitochondrial membrane protein prohibitin in scWAT (Figure 3A). When compared with the control mice, the diameter of fat cells in HFD mice increased and the number of cells per unit area decreased. When compared with HFD mice, the adipocytes of the mice in the emodin (40 mg/kg, 80 mg/kg) groups are small and tightly arranged, with obvious nuclei. As an important thermogenic protein, UCP1 is specifically expressed in BAT (6, 29). Prohibitin, mainly located in the inner membrane of mitochondria, plays an important role in maintaining mitochondrial morphology, function and regulating energy metabolism (30). Therefore, we measured the expression of UCP1 and prohibitin protein in scWAT (Figure 3B). The expression of UCP1 and prohibitin protein in scWAT of emodin 80 mg/kg-treated group was significantly increased (P <0.01), Compared with HFD mice. We also evaluated the mRNA expression of beige adipocyte marker genes, such as Cd137, Transmembrane protein 26 (Tmem26) and Tbx1. As expected, the expression of several beige adipocyte marker genes, including Cd137, Tmem26 and Tbx1, was significantly upregulated in scWAT after emodin (80 mg/kg) and CL316243ā (1 mg/kg) treatment (Figure 3C).
In order to confirm whether emodin can induce the browning of scWAT, we measured thermogenic protein and fatty acid transporter (Figure 3D). The expression of UCP1, prohibitin, CD36, FATP4 and PPARĪ± protein in scWAT of emodin (80 mg/kg) and CL316243ā (1 mg/kg) treatment group increased significantly, when compared with HFD mice (P <0.05 or P <0.01) (Figures 3EāI). These results suggested that emodin could induce the browning of scWAT in HFD mice.
Effects of emodin on the morphology and function of scWAT in HFD mice.H&E and immunohistochemical staining of scWAT.Relative expression of UCP1 and Prohibitin protein in scWAT.Relative expression of,andmRNA in scWAT.Protein expression of UCP1, prohibitin, PPAR Ī±, CD36 and FATP4 in scWAT using western blotting.Protein expression of UCP1.Protein expression of prohibitin.Protein expression of PPAR Ī±.Protein expression of CD36.Protein expression of FATP4. HFD, high fat diet; Emo, emodin. Data are expressed as mean Ā± SE.< 0.05,< 0.01HFD group. (A) (B) (C) (D) (E) (F) (G) (H) (I) Cd137 Tmem26 Tbx1 P P vs. * **
Emodin Activates Brown Adipose Tissue in Mice Fed With HFD
We also analyzed the morphology of BAT and the expression of thermogenic protein UCP1 and mitochondrial membrane protein prohibitin in BAT (Figures 4AāC). When compared with control mice, the diameter of fat cells in BAT of HFD mice was significantly increased, the number of cells per unit area decreased, and the number of white fat cells increased. This indicates that long-term HFD feeding results in so-called āwhiteningā of BAT. When compared with HFD mice, the adipocytes of the mice in the emodin (40 mg/kg, 80 mg/kg) groups are small and tightly arranged, with large and obvious nuclei. We also measured the expression of UCP1 and prolibitin protein in BAT. The expression of UCP1 and prohibitin protein in BAT of emodin and CL316243ā-treated group was significantly increased (P <0.05 or P <0.01), when compared with HFD mice.
To confirm that emodin can activate BAT of HFD mice, we measured thermogenic protein and fatty acid transporter (Figure 4D). The expression of UCP1, prohibitin, CD36, FATP4 and PPARĪ± protein in BAT of emodin and CL316243ā-treated group increased significantly, when compared with HFD mice (P <0.05 or P <0.01) (Figures 4EāI). These results suggested that emodin could activate BAT in HFD mice.
Effects of emodin on the morphology and function of BAT in HFD mice.H&E and immunohistochemical staining of BAT.Relative expression of UCP1 in BAT.Relative expression of prohibitin in BAT.Protein expression of UCP1, prohibitin, PPAR Ī±, CD36 and FATP4 in BAT using western blotting.Protein expression of UCP1.Protein expression of prohibitin.Protein expression of PPAR Ī±.Protein expression of CD36.Protein expression of FATP4. HFD, high fat diet; Emo, emodin. Data are expressed as mean Ā± SE.< 0.05,< 0.01HFD group. (A) (B) (C) (D) (E) (F) (G) (H) (I) * ** P P vs.
Phospholipid Metabolism Is Altered in scWAT With Emodin Treatment
Based on the above experimental results, we analyzed scWAT by targeted metabolomics. We selected the biomarkers that have changed and created a heat map (Figures 5AāE). The lipidomics data show that emodin treatment can perturb the lipidomics profile in HFD mice, and several phospholipid species (e.g. Cer, LPC, LPC-O, and PE-O) are remarkably increased in scWAT, indicating a remodeling of phospholipids after emodin 80 mg/kg treatment. Specifically, when compared with HFD mice, concentration of Cer (34:2), LPC (18:2), LPC-(O-20:2), PC (O-40:7), PE (O-36:3), PE (O-38:6), PE (O-40:6), and SM (41:0) was significantly up-regulated in emodin-treated group. Otherwise, levels of PC (O-38:6), PE (O-40:4), PE (O-40:5) were significantly reduced in emodin-treated group, when compared with HFD mice.
Effects of emodin on the lipid metabolites in scWAT of HFD mice.The content of Cer in scWAT.The content of LPC in scWAT.The content of LPC-O in scWAT.The content of PE-O in scWAT.Heat map. Only metabolites with VIP >1 and0.05 were selected in heat map, and different shades of color present the concentration (red, white and blue presented the high, normal and low concentration). The red up arrow indicates up regulation or promotion, and the blue down arrow indicates down regulation or inhibition. HFD, high fat diet; Emo, emodin; PC, phosphatidylcholine; PE, phosphatidylethanolamine; Cer, ceramides; LPC, lyso-phosphatidylcholine. Data are expressed as mean Ā± SE.< 0.05,< 0.01HFD group. (A) (B) (C) (D) (E) P < P P vs. * **
Phospholipid Metabolism Is Altered in BAT With Emodin Treatment
In addition, we also analyzed BAT by targeted metabolomics. We selected the biomarkers that have changed and created a heat map (Figures 6AāE). In BAT, the lipidomics indicated a significant reduction of PEs and PCs in BAT of HFD mice. And emodin treatment caused a significant increase of PEs and PCs in BAT, when compared with HFD mice. The increase in total PC was driven by significant increase of PC (30:0), PC (32:1), PC (32:2), PC (33:4) and PC (38:0) species, as well as species of LPC [e.g. LPC (20:0), LPC (20:1), LPC (22:0), LPC (22:1), LPC (24:0), LPC (24:1)] with emodin treatment. In addition, when compared with the control mice, the ratio of PC/PE was significantly increased in HFD-induced mice (P <0.05 or P <0.01). And emodin at the doses of 40 and 80 mg/kg and CL 316243 significantly decreased the ratio of PC/PE compared with HFD-induced mice.
Effects of emodin on the lipid metabolites in BAT of HFD mice.The content of Cer in BAT.The content of PC in BAT.The content of PE in BAT.The ratio of PC : PE in BAT.Heat map. Only metabolites with VIP >1 and0.05 were selected in heat map, and different shades of color present the concentration (red, white and blue presented the high, normal and low concentration). The red up arrow indicates up regulation or promotion. HFD, high fat diet; Emo, emodin; PC, Phosphatidylcholine; PE, phosphatidylethanolamine; Cer, ceramides. Data are expressed as mean Ā± SE.< 0.05,< 0.01HFD group. (A) (B) (C) (D) (E) P < P P vs. * **
Discussion
Emodin ameliorates adiposity and improves whole-body metabolic balance in obese mice. In this study, we demonstrated that emodin could decrease the body weight and food intake in high fat diet induced obese mice, also it could improve the glucose tolerance and reduce the blood lipids, which was consistent with the results of previous studies in vivo (22, 31, 32). The regulating of white adipose tissue and brown adipose tissue acts a critical role in combating obesity and metabolic disease. As a thermogenic tissue, BAT is innervated by both sympathetic and sensory nerves. The activity and metabolism of BAT could be influenced by cold exposure and exercise (33), as well as some natural product extracts or compounds, such as rose hip supplement (34), black raspberry (35), green tea extract (36), genistein (37), pentamethylquercetin (38), and etc. Here, we first proved that emodin could promote browning in scWAT. The white adipose tissue mass was decreased after emodin treatment. After treatment of emodin, more multilocular lipid droplets were found in scWAT, the mRNA expression of browning markers including Cd137, Tmem26 and Tbx1 was increased in scWAT, and the protein expression of browning markers including UCP1 and prohibitin was increased in scWAT of obese mice. Meanwhile, the protein expression of UCP1, prohibitin, PPARĪ± was increased in BAT of obese mice after emodin treatment. PPAR Ī± is the key factor of BAT thermogenesis, which can regulate lipid catabolism and thermogenic gene expression in coordination with Pgc-1Ī± and Prdm16 (39). PPAR Ī± can enhance the expression of PGC-1Ī± and UCP-1 by increasing the activity of erythropoietin (EPO). PPAR Ī± also plays a coordinating role with SIRT1 activated by EPO and jointly regulates the level of NAD+ to heighten the metabolic activity (40). The mitochondria are involved in the metabolic control of brown adipocytes. Mitochondrial function is related to the endocrine function of adipocytes. In addition, brown adipocytes rely on mitochondria to maintain intracellular metabolism. Located in mitochondrial inner membrane, prohibitin plays a critical role in maintaining the shape and function of mitochondria and regulating energy metabolism (30, 41). The results of western blotting demonstrated that emodin increased the protein expression of PPAR Ī± and prohibtin of scWAT and BAT in obese mice. As a fatty acid translocase, CD36 acts a pivotal part in the uptake and transport of long-chain fatty acids (LCFA) in heart and adipose tissues (42, 43). It was found that cold exposure drastically accelerated plasma clearance of triglycerides as a result of increased uptake into BAT, a process crucially dependent on local LPL activity and transmembrane receptor CD36 (44). Fatty acid transporter 4 (FATP 4) is a member of the fatty acid transport proteins (FATPs), which plays a significant role in the transport of long-chain fatty acids with more effectively compared with FATP1. It was found that FAT/CD36 and FATP4 were the most effective fatty acid transporters (45, 46). In this study, emodin accelerated the transport and consumption of fatty acids and improved the disorder of lipid metabolism by increasing the expression of CD36 and FATP4 protein in both scWAT and BAT of HFD-induced mice.
White and brown adipocytes exhibit different lipid metabolic signature, which reflect their distinct organelle composition and cell functions. The neutral lipids in the lipid droplets core are surrounded by a monolayer of phospholipids (47). PCs, PEs and CLs make up 89% of the phospholipids in BAT, which are increased in response to cold exposure and exercise (48). It was confirmed that regulation and metabolism of PCs, PSs and PEs prevented inflammation of adipose tissue, hyperlipidemia and obesity (49). Exercise can increase specific molecular species of PCs and PEs in brown adipocytes. It has been reported that after exercise, the increase in total PC was driven by the significant increase of the highly abundant PC (36:2) species, as well as increases in numerous species of PC and PC-O. However, there was no overall change in abundance of PE after exercise in BAT (1). Our recent study manifested that the lipidomic profile of adipocytes was remolded with high fat diets, and emodin treatment could perturb the profile and reverse some small lipid metabolites of HFD mice.
Furthermore, the relative abundance of PCs and PEs on the surface of LDs is important for their dynamics (50). An increase in the relative amount of PEs on the surface of lipid droplets can promote fusion of smaller droplets into larger ones (51). Inhibition of PCs biosynthesis can promote TG storage increases the size of the lipid droplets presumably (52, 53). Either abnormally high, or abnormally low cellular PC : PE molar ratios can influence energy metabolism in various organelles (50). It has been shown that both PC amount and PC : PE molar ratio tend to increase, and palmitate- and stearate-containing LPC species were upregulated in 16-week-old Lepob/ob adipose tissue macrophage, which related to WAT inflammation and contribute to the development of insulin resistance in obesity (54). It has been proved the different composition of phospholipids in white and brown adipocyte, and thermogenic adipocytes possess higher abundance of PCs and PEs, with longer (C >36) and more polyunsaturated species (55). Our results also indicated that the ratio of PC : PE was significantly increased in brown adipose tissue but not scWAT in HFD-induced mice compared with control mice. Interestingly, emodin 40 and 80 mg/kg treatment and CL 316243 could significantly increase abundance of PCs and PEs, and decrease the PC : PE ratio in BAT of obesity mice. Specifically, emodin significantly up-regulated levels of Cer (34:2), LPC (18:2), LPC-(O-20:2), PC (O-40:7), PE (O-36:3), PE (O-38:6), PE (O-40:6), and SM (41:0), and down-regulated PC (O-38:6), PE (O-40:4), PE (O-40:5) in scWAT compared with HFD mice. And in BAT, the remarkable increase in total PCs was driven by significant increase of PC (30:0), PC (32:1), PC (32:2), PC (33:4) and PC (38:0) species with emodin treatment. In addition, emodin significantly increased species of LPC (e.g. LPC (20:0), LPC (20:1), LPC (22:0), LPC (22:1), LPC (24:0), when compared with HFD mice.
Conclusion
These results indicated that emodin could ameliorate adiposity and improve metabolic disorders in obese mice. Also, emodin could promote browning in scWAT and activate the BAT activities. In addition, emodin treatment-induced changes to the scWAT and BAT lipidome were highly specific to certain molecular lipid species, indicating that changes in tissue lipid content reflects selective remodeling in scWAT and BAT of both glycerophospholipids and sphingolipids in response to emodin treatment.
Data Availability Statement
The raw data supporting the conclusions of this article will be made available by the authors, without undue reservation.
Ethics Statement
All the animal studies were in accordance with ethics standards of the Animal Care and Welfare Committee of Beijing University of Chinese Medicine [Certificate No. BUCM-04-2018070603-3015].
Author Contributions
JS and SD designed experiments. LC, SZ, FS, YN, ZH, RH, and SD performed experiments. FS and LC performed UPLCQ-MS/MS analysis. LC and SD performed statistical analysis. LC wrote the paper. All authors contributed to the article and approved the submitted version.
Funding
This paper was supported by the National Natural Science Foundation of China (Grant No. 81503287, 81430094), Natural Science Foundation of Beijing Municipality (Grant No. 7144222, 7174312), and Doctoral Program Foundation of Institutions of Higher Education of China (Grant No. 20130013120002).
Conflict of Interest
The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.
Abbreviations
WAT, white adipose tissue; BAT, brown adipose tissue; HFD, high-fat diet; scWAT, subcutaneous white adipose tissue; UCP1, uncoupling protein 1; PPARĪ±, Peroxisome proliferator-activated receptor alpha; PGC-1Ī±, Peroxisome proliferator activated receptor Ī³ coactivator-1Ī±; PRDM16, positive regulatory domain-containing 16; PHB, prohibitin; AMPK, AMP activated protein kinase; SREBP, sterol regulatory element-binding protein; Tmem26, Transmembrane protein 26; TC, total cholesterol; TG, triglyceride; HDL-c, high-density lipoprotein cholesterol; LDL-c, low-density lipoprotein cholesterol; FFA, free fatty acid; AUC, area under circle; IR, insulin resistance; LCFA, long-chain fatty acids; FATP 4, Fatty acid transporter 4; PC, Phosphatidylcholine; PE, phosphatidylethanolamine; PS, phosphatidylserine; SM, sphingolipid; Cer, ceramides; LPC, lyso-phosphatidylcholine; LPE, lyso-phosphatidylethanolamine.
References
Associated Data
Data Availability Statement
The raw data supporting the conclusions of this article will be made available by the authors, without undue reservation.