What this is
- This research investigates the impact of gut colonization with () on plasma () levels in mice.
- is linked to atherosclerosis, and its levels can be affected by gut microbiota.
- The study evaluates the efficacy of different species in reducing concentrations and potential effects on atherosclerosis.
Essence
- Gut colonization with Methanobrevibacter smithii significantly reduces plasma levels in Apoe-/- mice, indicating a potential anti-atherogenic effect.
Key takeaways
- Gut colonization with M. smithii led to a significant reduction in plasma concentrations, averaging 18.2 ± 19.6 μM compared to 120.8 ± 13.0 μM in control mice.
- Mice colonized with M. smithii showed a 44% decrease in aortic plaque area and a 52% reduction in fat content in atherosclerotic plaques, although these findings did not reach statistical significance.
- Repeated transplantation of M. smithii, combined with antibiotic treatment, resulted in sustained lower levels and improved gut colonization.
Caveats
- The study was conducted with a small number of mice, which limits the generalizability of the findings.
- Statistical significance was not achieved for the reductions in aortic plaque area and fat content, indicating that further research is needed.
- The potential mechanisms by which affect and atherosclerosis require further investigation.
Definitions
- trimethylamine N-oxide (TMAO): A metabolite produced from dietary choline and other compounds by gut bacteria, associated with cardiovascular diseases.
- methanogenic archaea (MA): A group of microorganisms that produce methane and can utilize methylated amines like TMA as growth substrates.
AI simplified
Introduction
Atherosclerotic vascular disease is the leading cause of death in the US1. The gut microbiome is now recognized as a mediator of numerous host physiological processes. Changes in the gut microbiome have been causally linked to several metabolic, inflammatory, and cardiovascular diseases, including atherosclerosis2,3. Systemic concentrations of the gut microbe-derived metabolite, trimethylamine-N-oxide (TMAO), is associated with atherosclerosis and major adverse cardiovascular events4–6. Choline diet dependent enhancement in atherosclerosis could be prevented by either gut microbiota suppression with broad spectrum antibiotics6, or in more recent studies, administration of an inhibitor of microbial choline trimethylamine (TMA) lyase activity and therefore TMAO generation (4,4-dimethyl-1-butanol)7, indicating a causal link between TMAO and atherosclerosis. In this study, we tested a novel microbiota-based approach to reduce systemic exposure of TMAO.
Gut microbes generate TMA from ingested precursors, including choline6, carnitine4, phosphatidylcholine5, betaine8, and trimethyllysine9. TMA is converted to TMAO by the host hepatic flavin monooxygenase 3 (FMO3)10. Multiple phylogenetically distinct bacteria are involved in TMA production11. There are many microbial families, genus, and species which possess microbial enzymes that can make TMA. There have been three microbial enzyme genes/sources of TMA thus far identified; the cutC/D11, the cntA/B gene12, and the YeaW/Z gene13.
In humans, FMO3 gene mutations cause the inherited disorder primary trimethylaminuria (TMAU)14, also known as the fish odor syndrome, which severely reduces the ability to convert TMA to TMAO. Consequently, the affected individuals excrete large amounts of odorous TMA in their urine, sweat, and breath15. Although the disorder is not known to affect patient health, it can have profound social and psychological consequences. Development of a probiotic that can catalytically consume TMA could also serve as a therapeutic approach for treating this genetic disorder.
Methanogenic archaea (MA) represents a distinct group of anaerobic archaea that produce methane as the end-product of their anaerobic respiration. The abundance and diversity of gut MA in humans is highly variable and limited to a few species16–18. Methanobrevibacter smithii is the dominant methanogen in the human gut, detected in 95.7% of individuals, whereas Methaomassiliicoccus luminyensis is detected only in 4% of individuals19. Certain MA such as Methanosarcina species are known to use methylated amines as growth substrates20,21. A catabolic microbe that literally consumes TMA preventing/intercepting TMA prior to when it can be absorbed and converted into TMAO, would serve as a therapeutic intervention. However, up until now this potential has largely remained a theoretical concept. However, up until now this potential has largely remained a theoretical concept. In this study, we tested the effect of MA colonization on blood TMAO level and atherosclerosis burden in the atherosclerosis prone Apoe−/− mouse model.
Materials and Methods
All methods were performed in accordance to guidelines and regulations, and under approval of the Institutional Biosafety Committee of The George Washington University.
Methanogenic archaea (MA)
Selected species of known human gut and non-gut MA including: (a) Methanobrevibacter smithii, strain PS (DSM-86), (b) Methaomassiliicoccus luminyensis, strain B10 (DSM-25720), (c) Methanosarcina mazei, strain S-6 (DSM-2053), (d) Methanoimicrococcus blatticola, strain PA (DSM-13328) and (e) Methanohalophilus portucalensis, strain FDF-1 (DSM-7471) were obtained from DSMZ (Germany). M. smithii and M. luminyensis were selected because these are indigenous human gut MA22. For comparison, we selected M. blatticola (isolated from the hindgut of cockroach Periplaneta americana)23, M. mazei (isolated from a laboratory digester)24, and M. portucalensis (isolated from sediments at a saline lake)25.
Animal Studies
| Mouse experiment | Mouse model | Archaea species studied | of mice/group (N)# | Duration of study (weeks) | Transplant frequency | Antibiotic treatment |
|---|---|---|---|---|---|---|
| 1 | C57BL/6 | MS, MM, MB, ML, MP | 3 | 4 | Once | Pre-transplant |
| 2 | Apoe−/− | MS, MM, MB | 5 | 4 | Once | Pre-transplant |
| 3 | Apoe−/− | MS | 5 | 12 | Every 3 weeks | Pre- and post-transplant |
Quantification of MA
Gut colonization by the MA was determined using quantitative real-time PCR (q-PCR). Briefly, microbial DNA was extracted from stool samples using the Qiagen DNeasy PowerSoil kit. The stool specimens were tested for the levels of engraftment by q-PCR as previously described26. Arch344f (ACGGGGYGCAGCAGGCGCGA)26 and Arch806r (GGACTACCCGGGTATCTAAT)27 primers were used to target the archaea 16 S rRNA gene present in MA. Q-PCR was performed for detection and quantification of microbes using SYBR Green PCR Master Mix (Applied Biosystems, Foster City, CA) in an Applied Biosystems 7900HT Sequence Detection system (Applied Biosystems)28. PCR products amplified from the bacterial and archaeal 16 s rRNA genes were cloned and grown in transformed E. coli to establish a standard curve, as described previously29. The accuracy of the q-PCR assay was confirmed through melting curve analysis and agarose gel electrophoresis. Calibration curves were obtained using 10-fold serial dilutions of known concentrations of cloned DNA samples that were prepared in the laboratory.
16S rRNA-based taxonomic survey
| v4L_BT517 | AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTACGACGTGGTGYCAGCMGCCGCGGTAA |
| v4L_13_R | CAAGCAGAAGACGGCATACGAGATGGACTTCCAGCTGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTCCGYCAATTYMTTTRAGTTT |
| v4L_14_R | CAAGCAGAAGACGGCATACGAGATCTCACAACCGTGGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTCCGYCAATTYMTTTRAGTTT |
| v4L_15_R | CAAGCAGAAGACGGCATACGAGATCTGCTATTCCTCGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTCCGYCAATTYMTTTRAGTTT |
| v4L_16_R | CAAGCAGAAGACGGCATACGAGATATGTCACCGCTGGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTCCGYCAATTYMTTTRAGTTT |
| v4L_17_R | CAAGCAGAAGACGGCATACGAGATTGTAACGCCGATGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTCCGYCAATTYMTTTRAGTTT |
| v4L_18_R | CAAGCAGAAGACGGCATACGAGATAGCAGAACATCTGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTCCGYCAATTYMTTTRAGTTT |
| v4L_19_R | CAAGCAGAAGACGGCATACGAGATTGGAGTAGGTGGGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTCCGYCAATTYMTTTRAGTTT |
| v4L_20_R | CAAGCAGAAGACGGCATACGAGATTTGGCTCTATTCGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTCCGYCAATTYMTTTRAGTTT |
| v4L_21_R | CAAGCAGAAGACGGCATACGAGATGATCCCACGTACGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTCCGYCAATTYMTTTRAGTTT |
| v4L_22_R | CAAGCAGAAGACGGCATACGAGATTACCGCTTCTTCGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTCCGYCAATTYMTTTRAGTTT |
| v4L_23_R | CAAGCAGAAGACGGCATACGAGATTGTGCGATAACAGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTCCGYCAATTYMTTTRAGTTT |
| v4L_24_R | CAAGCAGAAGACGGCATACGAGATGATTATCGACGAGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTCCGYCAATTYMTTTRAGTTT |
Plasma TMAO measurement
Ultra performance liquid chromatography-tandem mass spectrometry (UPLC-MS/MS) was used to measure plasma TMAO concentrations as described previously with minor modification36. Briefly, the UHPLC-MS/MS system consisted of an Acquity UPLC I-class sample mannager (Waters, Milford, MA), Acquity UPLC I-class binary solvent mannager, and a TSQ Quantum Ultra triple quadrupole mass spectrometer (Thermo, San Jose, CA). For protein precipitation, plasma (50 µL) was combined with an internal standard (200 µL of d9-TMAO 0.5 µg/mL) in methanol. After centrifugation, 20 µL of supernatant was diluted with 100 µL of 75:25 acetonitrile:methanol and 5.0 µL of this mixture was injected onto the UPLC-MS/MS system. The standard curve ranged from 0.010–5.00 µg/mL (0.13–66.6 µM). The within-run and between-run precision (percent coefficient of variation) was <15%.
Assessment of atherosclerosis
At the end of each study, mice were euthanized, and the heart was removed just proximal to the aortic arch. The heart was cut transversely at the level of the atria and placed ventricle down into a tissue mold in optimal cutting temperature compound (OCT compound) and stored at −20 °C until sectioning. Multiple cryosections at 10 μ thickness were taken of the aortic sinus and aortic root and stained for fat content with Oil-Red-O (ORO). Six sections from each heart were selected for image analysis, including the first section that contained the three leaflets of the aortic valve and the next 5 sections at 40 μ intervals along the aortic root distal to the valve over a total distance of 200 μ. The area of the plaque and the content of ORO was quantified by image analysis (ImageJ software) and calculated as an average of the area of plaque found in each of the 6 individual aortic valve sections taken for analysis37. Two animals from the negative control group and one of the transplanted animals died prior to obtaining samples for atherosclerosis evaluation.
Statistical Analyses
We used analysis of variance and Student’s t test to compare mean plaque size between groups. A random effects mixed model was used to examine the species main effect (with levels M. smithii, M. mazei, and M. blatticola, M. luminyensis, M. portucalensis, and control), the time main effect (day 2, 10, 30), and the species x time interaction Values are presented as mean ± SD, and those with a value of P < 0.05 were considered significant. Data analysis was performed using SAS 9.4.
Results
MA can colonize normal C57BL/6 mice guts and lower their plasma TMAO concentrations
The plasma TMAO concentration was markedly elevated in the group of mice that were on the choline/TMA-supplemented water (positive control) compared to the negative control mice fed with regular water (153.6 ± 2.8 vs. 10.1 ± 7.0 μM, p < 0.001). On day 2 post-transplant, plasma TMAO concentrations were significantly lower in mice colonized with M. smithii (14.8 ± 15.7 μM, p = 0.003), M.mazei (6.9 ± 10.6 μM, p < 0.001), M. blatticola (5.9 ± 3.8 μM, p < 0.001), M. luminyensis (102.3 ± 27.3 μM, p = 0.03), and M. portucalensis (45.57 ± 16.8 μM, p < 0.01), compared to the positive control mice (Fig. 1B). TMAO concentrations showed a rebound increase from day 10 post-transplantation, which paralleled the decline in MA colonization levels.
MA can colonize normal C57BL/6 mice guts and lower their plasma TMAO concentrations. () Q-PCR analysis of fecal samples from C57BL/6 mice transplanted with one of five different representative gut- and non-gut MA, namely:.,.,.,., and.. Stool samples were collected at days 2, 10, and 30 post-transplantation. () Plasma TMAO concentrations in mock- and MA-transplanted C57BL/6 J mice collected at days 2, 10 and 30 post-transplantation. Mock-transplanted negative control mice (NC) only received regular water, whereas mock-transplanted positive control mice (PC) received high choline/TMA water, similar to MA-transplanted mice. A B M smithii M mazei M blatticola M luminyensis M portucalensis
MA can colonize Apoemice guts and lower their plasma TMAO concentrations −/−
MA can colonize Apoemice guts and lower their plasma TMAO concentrations. () Q-PCR analysis of fecal samples frommice transplanted with one of the 3 different MA, namely:.,.,.. Stool samples were collected at days 2, 10, and 30 post-transplantation. () Plasma TMAO concentrations in mock- and MA-transplantedmice collected at days 2, 10 and 30 post-transplantation. Mock-transplanted negative control mice (NC) only received regular water, whereas mock-transplanted positive control mice (PC) received high choline/TMA water, similar to MA-transplanted mice. −/− −/− −/− A B Apoe M smithii M mazei and M blatticola Apoe
Repeated transplantation of Apoemice with.in presence of antibiotics leads to stable and high level gut colonization and diminishes the plasma TMAO concentrations −/− M smithii
Repeated transplantation of Apoemice with.in presence of antibiotics leads to stable and high level gut colonization and diminishes the plasma TMAO concentrations. () To maintain a high level of gut colonization with the MA,., transplantation was repeated every 3 weeks for the duration of the study. A second group of mice (+Antibiotics) was also maintained on vancomycin and ampicillin, in addition to receiving repeated transplantations. Weekly blood and stool samples were collected from the mice for 9 weeks. Stool samples were analyzed by q-PCR for MA engraftment levels. () Plasma TMAO concentrations in mock- and.-transplantedmice (±antibiotics) collected weekly for 9 weeks post-transplantation. Mock-transplanted positive control mice (PC) received high choline/TMA water, similar to.-transplanted mice, but not antibiotics. −/− −/− M smithii M smithii M smithii Apoe M smithii A B
Antibiotic depletion of Firmicutes enhances gut colonization by. M smithii
At the genus level, the untreated mouse microbiome was dominated by Bacteroides at the baseline, while Clostridium and Turicibacter trended higher among the remaining bacteria in antibiotic-treated mice (Fig. 4B). Choline/TMA supplemented mouse microbiome was dominated by Akkermansia, which was replaced by Clostridium and Turicibacter in M. smithii-colonized mice. There was a significant difference in the colonization levels of M. smithii between the antibiotic treated and untreated mice, and the proportional distribution of classes of bacteria varied significantly. Functional analysis using PICRUSt35 showed that purine and pyrimidine metabolism, methane metabolism, and “phenylalanine, tyrosine and tryptophan biosynthesis pathways were active. (Fig. 4C).
Antibiotic depletion of Firmicutes enhances gut colonization by..mouse gut microbiome characterization based on 16 S rRNA gene sequencing. Shown is the histogram of proportional changes in gut microbiota OTU abundance at the () phylum and () genus levels as measured for the different groups (NC, PC, No-antibiotics, antibiotic). () Metabolic potential of.-colonized mice compared to un-transplanted mice. M smithii Apoe M smithii −/− A B C
Stable.gut colonization trends towards attenuation of choline/TMA-enhanced atherosclerosis M smithii
Stable.gut colonization trends towards attenuation of choline/TMA-enhanced atherosclerosis. () Representative Oil-Red-O (ORO)/hematoxylin staining of aortic root sections from 19-week-old femalemice that were fed chemically defined chow (0.07% total choline), in the presence versus absence of choline/TMA (1.0% total choline; 1.2% TMA) provided in the drinking water, and either mock- or.-transplanted, as described in the Experimental Procedures. Scale bars, 500 μm. The AB-POS group was maintained on antibiotics in their drinking water for the duration of the experiment following transplantation. () Aortic root lesion plaque area and () ORO staining in the plaque area were quantified in 19-week-old femalemice from the indicated diet and.transplanted groups. Data are presented as mean ± SE. M smithii Apoe M smithii Apoe M smithii A B C −/− −/−
Discussion
In this study, we investigated the in vivo TMA-metabolizing efficacy of several gut and not-gut associated methyl-trophic methanoarchaea of the genera Methanomicrococcus (Methanomicrococcus blatticola); Methanosarcina (Methanosarcina mazei), Methanohalophilus (Methanohalophilus portucalensis), and Methanomassiliicoccus (Methanomassiliicoccus luminyensis). The ability of all of these species to grow on TMA in culture has been previously demonstrated23,25,38,39. Also included in this study, was M. smithii, a member of Methanobrevibacter genus which is the most predominant methanoarchaea in the human gut. Unlike the other methanoarchaea used in this study, M. smithii is not known to grow on TMA in culture. However, a recent study demonstrated that many essential genes involved in methanogenesis, including methyltransferases are present and significantly up-regulated in vivo when M. smithii was co-colonized with a prominent human gut symbiont40.
We show that gut colonization with MA, consistently and significantly reduces plasma TMAO concentrations in two different mouse models that were maintained on a high choline and TMA diet. The reduction in plasma TMAO concentrations, in general paralleled the abundance of MA in the gut. We initially screened five species of MA isolated from gut and non-gut environments and noted that the colonization efficacy and the TMAO lowering efficacy is highest with M. smithii, a normal inhabitant of the human gut. Unlike M. smithii, the other indigenous human gut methanoarchaea, M. luminyensis, was very poor at gut colonization in mice and lowering blood TMAO levels. This observation is however, in accordance with the reports on low prevalence of M. luminyensis which is detected only in 4% of individuals, compared to that of M. smithii which has a high prevalence of nearly 96%19.
16 s rRNA sequencing showed that antibiotics, choline/TMA and M. smithii colonization led to distinct change in microbiome profile and functional changes in gene expression. Compared to Apoe−/− mice fed with high choline/TMA diet, mice colonized with M. smithii had 44.2% lower atherosclerotic burden and 52.2% reduced fat content in the atherosclerotic plaques, but these differences did not reach statistical significance possibly due to the small sample size.
Increased systemic exposure of TMAO is associated with atherosclerosis and major adverse cardiovascular events4–6. TMAO originates from the microbiota-dependent breakdown of dietary phosphatidylcholine to TMA. Functional studies have shown that TMAO decreases expression of bile acid transporters in the liver and reduces synthesis of bile acids from cholesterol4. TMAO also inhibits reverse cholesterol transport and promotes accumulation of cholesterol in macrophages through increasing cell surface expression of proatherogenic scavenger receptors CD36 and Scavenger Receptor A6, thus, creating foam cells that subsequently accumulate in the endothelial wall causing inflammation and plaque formation. Another mechanism related to atherosclerosis is the increase in thrombosis mediated by TMAO41.
It is therefore, not surprising that there is considerable interest in treatments designed to lower TMAO concentrations7. Targeting gut microbial production of TMA using a structural analog of choline, 3,3-dimethyl-1-butanol, inhibits TMA formation and lowers TMAO concentrations in mice fed a high-choline or L-carnitine diet7. 3,3-dimethyl-1-butanol inhibited choline diet-enhanced endogenous macrophage foam cell formation and atherosclerotic lesion development in Apoe−/− mice7. In this study, we took a different approach and aimed at depleting TMA as it is being formed by MA. In vitro studies have shown that certain MA can utilize TMA as a substrate for growth38. However, this is the first in vivo study that examines the utility of MA in decreasing plasma TMAO concentrations.
We used a logical step-wise approach including screening, discovery and validation. For our initial screening, we chose normal C57/BL6 mice to evaluate the gut colonization capability and TMAO lowering efficacy of five selected species of MA. Subsequently, we tested the TMAO lowering efficacy of the three top performing MA in Apoe−/− mice. In the final experiment, we examined the effect of repeated transplantation with M. Smithii, and chronic suppression of endogenous bacteria by antibiotics, on colonization efficacy, TMAO concentrations and atherosclerosis level in Apoe−/− mice.
Our initial study in C57BL/6 mice showed that all MA tested were able to colonized the gut and reduce TMAO concentrations irrespective of their original habitat, but with large inter-individual variations. Efficient gut colonization by M. smithii was evident, but the colonization level of the other human gut MA, M. luminyensis, was poor. In the second experiment, a significant reduction in plasma TMAO concentrations were also observed in Apoe−/− mice transplanted with M. smithii (90.4%), M. mazei (92.5%), and M. blatticola (94%) on the 2nd day, compared to non-transplanted control animals fed with high choline/TMA diet. Our initial experiments in both C57BL/6 and Apoe−/− mice revealed that, even after a 3-week-long antibiotic depletion of the gut bacteria, colonization was only transient with a single dose of MA. In a 3rd experiment, we show that repeated transplantations significantly improved the gut colonization levels, which was further improved by antibiotic suppression of endogenous gut bacteria. There was a corresponding sustained reduction in TMAO concentrations. 16 S sequencing analysis confirmed that maintaining the transplanted mice on antibiotics greatly enhances M. smithii engraftment, but depleted Firmicutes and enriched Proteobacteria.
We chose to test M. smithii because it is known to be the most predominant MA in the human gut. M. smithii thrives in the distal intestine through its versatility in consuming the fermentation products made by saccharolytic bacteria, and by its ability to produce surface glycans and adhesion-like proteins40. M. luminyensis also colonizes human gut, although at much lower levels compared to M. smithii19. In human gut, TMA-metabolizing MA depend on the gut microbiota for converting choline to TMA which serves as a carbon-source for MA. In return, MA facilitates the continuation of bacterial fermentation process in the gut by metabolizing and removing H2.
On a chow diet, Apoe−/− mice demonstrate a total cholesterol level >500 mg/dL, with fatty streaks first observed in the proximal aorta at 12 weeks of age, and fibrous plaques appearing at 20 weeks of age42. A Western diet43, or a choline-rich diet6, induce a marked increase in plaque size and aggressive plaque morphology. We found that gut colonization with M. smithii resulted in a tendency for reduced atherosclerosis burden in Apoe−/− mice fed with high choline/TMA diet. The results were not statistically significant, possibly due to small number of animals studied. In addition, we cannot exclude the possibility that factors other than TMAO contribute to the pathogenesis of atherosclerosis, which were unmodified by this intervention44.
Since our data on the lowering of plaque characteristics were not statistically significant, either this study needs to be repeated in a much larger cohort of animals, or it could be concluded that lowering TMAO (as significant as our study demonstrates), does not lower TMAO-induced atherosclerosis in Apoe−/− mice.
We acknowledge that this is a pilot study in small number of animals and that the study could have benefited from measurement of TMA and choline concentrations; however, the study has a number of strengths. Strengths include: (a) first study to explore the utility of gut colonization by MA to lower plasma TMAO concentrations; (b) the evaluation of several candidate gut and non-gut MA in two mouse models; (c) the examination of single vs. repeated transplantation effect of MA; and, (d) the determination of MA engraftment efficiency after suppression of the endogenous gut microbiome.
While we do not know and did not investigate the factors that support increased engraftment level of MA in mice maintained on antibiotics, we speculate that there may be other bacteria and/or bacteria-derived factors that would either compete with or inhibit MA gut colonization. Clearly, the use of antibiotic in this study was to enhance gut colonization in our mouse model and facilitate the study of MA impact on blood TMAO levels, and not a recommended method to enhance the MA gut colonization in human. Future studies are needed to identify the exact mechanism and factors that support or compete with MA engraftment in human gut, and the consequence of increased MA abundance on the human host physiology and health.
To date, the impact of methanogens on human physiology and health is poorly understood. Association between MA and inflammatory bowel disease, colorectal cancers and obesity has been reported, however, there is no convincing evidence supporting the pathogenic properties of the MA, beyond occasional reports of constipation45,46. M. smithii has been shown to enhance energy retrieval by another sacharolytic bacterial species when co-transplanted into germ-free mice47. A study of fecal DNA extracts from patients with colorectal cancer, polypectomised, irritable bowel syndrome and control subjects found no significant association between these diseases and the presence of MA48. There is also no conclusive evidence that MA is associated with colon cancer49,50.
To summarize, our study shows that gut colonization with certain MA reduces plasma concentrations of TMAO. Among the MA tested, M. smithii, an endogenous human gut MA, was most effective in lowering plasma TMAO levels in Apoe−/− mice fed with high choline/TMA, and showed a tendency to attenuate atherosclerosis. The anti-atherogenic potential of the MA should be confirmed in studies using larger number of animals. The field of microbiome research is still nascent, but is evolving rapidly. Therapeutic use of specific toxin-degrading gut commensal microbes as probiotics to lower the levels of uremic toxins such as TMAO is a novel concept, but if proven effective, it will have a significant impact on cardiovascular disease and progression of chronic kidney disease. Safety of MA should be tested in pilot studies prior to launching efficacy studies in human subjects.