How Stroke Affects Sleep Regulation and Body Clock in Rats

This study used 60 young Sprague–Dawley (SD) male rats (12 weeks old, 200–250 g) and 60 aged SD male rats (19–20 weeks old, 300–600 g). All rats were sourced from xxx and housed in a specific pathogen‐free animal facility. The environmental conditions were controlled at a temperature of 20°C–26°C, relative humidity of 40%–70%, and a 12‐h light/dark cycle. The animals were acclimatized for 1 week before the experiments. All procedures were approved by the Animal Ethics Committee of The 2nd Affiliated Hospital of Harbin Medical University (Approval No. SYDM2024‐087), and all experimental procedures followed the approved guidelines to ensure compliance with animal welfare regulations. Euthanasia was performed using an overdose of pentobarbital sodium (100 mg/kg intraperitoneally) to minimize animal suffering.

For image processing, Fiji (a distribution of imageJ, 37370, UGO BASILE, Italy) was used. Brain tissue sections were prepared using an animal brain slicer (Zivic, Pittsburgh, PA, USA). Other instruments involved in this study were shown as follows: electrophoretic transfer system (#1704150, Trans‐Blot Turbo, Bio‐Rad, USA), universal high‐speed refrigerated centrifuge (Sorvall Biofuge Stratos, Thermo Scientific, USA), microplate reader (Spectra Max M4, USA), gel imaging system (Image Quant LAS4000, Germany GE Company).

The middle cerebral artery occlusion (MCAO) model was used to induce IS in rats. Rats were anesthetized with isoflurane (Sigma‐Aldrich, USA) and a 6‐0 silk suture was used to occlude the internal carotid artery and common carotid artery for 1 h, followed by reperfusion with phosphate‐buffered saline (PBS, pH = 7.4) (10010001, Thermo Fisher Scientific, USA). After reperfusion, neurological function and infarct area (IA) were assessed at various time points (3, 6, 12, 24, and 48 h) [11].

The experimental design included both young and aged rats, divided into the following groups (n = 10 per group), with the same procedure applied to both age groups: (1) Sham group: rats underwent surgery without suture insertion. (2) MCAO group: subjected to 1‐h ischemia followed by reperfusion. (3) Sham‐sleep deprivation group: underwent sleep deprivation during the last 6 h of the light phase. (4) MCAO‐sleep deprivation group: MCAO rats subjected to sleep deprivation during the last 6 h of the light phase. (5) Sham‐recovery group: rats underwent sleep deprivation and sleep recovery during the first 3 h of the dark phase. (6) MCAO‐recovery group: MCAO rats underwent sleep deprivation and sleep recovery during the first 3 h of the dark phase.

All procedures, including treatment and evaluation time points, were performed identically for both the young and aged rat groups, ensuring consistency in the experimental conditions across age groups.

The Garcia scoring system was used to assess motor deficits, including spontaneous activity, symmetry of limb movements, forelimb extension, climbing ability, proprioception, and whisker response. The total score ranged from 0 to 18, with lower scores indicating more severe motor deficit [12]. Assessments were performed in a quiet, dimly lit room (red light) during the last hour of the dark phase.

Rats were euthanized under isoflurane anesthesia by cervical dislocation. The brains were quickly removed, rinsed with PBS, and sectioned into 1 mm‐thick coronal slices. Sections were incubated with 0.05% 2,3,5‐triphenyltetrazolium chloride (TTC) solution at 37°C in the dark for 30 min, followed by PBS rinsing and storage in 10% buffered formalin. The levels of cerebral infarction in both groups of rats were observed at various time points, and the percentage of infarction was calculated. The IA was calculated by subtracting the healthy tissue area from the total contralateral hemisphere area. The percentage of infarction was expressed as the ratio of the infarcted area to the total hemisphere area.

Serum levels of melatonin (#ab283259, Abcam, UK) and cortisol (#ab108665, Abcam, UK) were measured using enzyme‐linked immunosorbent assay (ELISA) kits according to the manufacturer's instructions. Blood samples in the young‐sham, young‐MCAO, aged‐sham, and aged‐MCAO groups were collected from the tail vein at 6, 12, 18, and 24 h post‐ischemia on days 2, 3, 5, and 7.

Total RNA was extracted from pineal gland tissues using TRIzol reagent (Invitrogen, USA). RNA was reverse transcribed into complementary DNA using the reverse transcription kit (TAKARA, Japan). Quantitative reverse transcription polymerase chain reaction assay (qRT‐PCR) was performed using SYBR greenER qPCR SuperMix (TaKaRa, Japan) on a Roche LightCycler 96 system. The relative expression levels of Perl and Cry1 were normalized to GAPDH and calculated using the 2^−ΔΔCt method.

The primer sequences used were as follows: Perl (F, 5′‐CTCTCCGCAACCAGGATACC‐3′; R, 5′‐GCTAGGAGCTCTGAGAAGCG‐3′); Cry1 (F, 5′‐CTGAAGGAGTGCATCCAGGG‐3′; R, 5′‐TGTCCCCGGATCACAAACAG‐3′); GAPDH (F, 5′‐GAAGGTCGGTGTGAACGGAT‐3′; R, 5′‐GGGTTTCCCGTTGATGACCA‐3′).

The protein expression levels of Per1 and Cry1 in the pineal gland were measured at multiple time points (2nd, 3rd, 5th, and 7th days). The total protein was extracted using a protein extraction kit (Thermo Scientific Pierce, USA), and the protein concentration was measured through a bicinchoninic acid assay kit (Thermo Scientific, USA). Next, the protein samples were separated using sodium dodecyl sulfate‐polyacrylamide gel electrophoresis and transferred to the polyvinylidene fluoride (PVDF) membranes. The PVDF membranes were blocked with 5% non‐fat milk for 2 h. After blocking, the membranes were incubated with primary antibodies at 4°C overnight, followed by secondary antibodies conjugated with horseradish peroxidase for 2 h. Signals were detected using enhanced chemiluminescence and quantified using Image J. Primary antibodies used were as follows: Per1 (#13463‐1‐AP, 1:1000, Proteintech), Cry1 (#PA1‐527, 1:2000, Thermo Fisher Scientific), and β‐actin (#MA1‐140, 1:5000, Thermo Fisher Scientific). Secondary antibodies included goat anti‐rabbit (#A27034, 1:2000, Thermo Fisher Scientific) and goat anti‐mouse (#31430, 1:5000, Thermo Fisher Scientific).

Electromyogram (EMG) electrodes were implanted above the neck muscles of rats to monitor sleep–wake cycles. After MCAO surgery, the rats were allowed to recover and adapt to the recording equipment for at least 5 days. During this period, continuous 48‐h EMG recordings were performed to verify the stability of electrophysiological signals and baseline sleep–wake cycles. Following a 12‐h recovery post‐surgery, sleep deprivation was performed during the last 6 h of the light phase, followed by a 3‐h recovery in the dark phase. EMG signals were recorded continuously throughout the light and dark periods.

Sleep deprivation was conducted on the second‐day post‐MCAO. Electroencephalography and EMG were recorded on days 2, 3, 5, and 7 to assess key sleep parameters, including waking time, non‐rapid eye movement (NREM) sleep time, rapid eye movement (REM) sleep time, NREM delta power, and REM theta power, across 24‐h cycles encompassing both light and dark periods. Circadian rhythms amplitude for wakefulness was calculated using the circadian index of wake (CI wake) formula: CI wake = (average dark—average light)/average 24 h.

Additionally, sleep latency, waking time, NREM and REM sleep, as well as NREM delta and REM theta power, were analyzed for the young‐sham‐sleep deprivation, young‐MCAO‐sleep deprivation, aged‐sham‐sleep deprivation, and aged‐MCAO‐sleep deprivation groups.

Statistical analyses were conducted using SPSS 21 software and graphs were created with Graphpad software. The Shapiro–Wilk test was employed to assess data normality, and Levene's test was applied to check the homogeneity of variance. For normally distributed data, results were expressed as mean ± standard deviation, and one‐way analysis of variance (ANOVA) was used for multiple comparisons, while independent samples t‐tests were used for comparisons between two groups. For non‐normally distributed data, non‐parametric tests such as the Mann–Whitney U test and the Kruskal–Wallis test were applied. Additionally, Pearson correlation analysis was utilized to evaluate the relationship between neurological deficits and IA. p < 0.05 was considered statistically significant.

To evaluate the neurological impact of IS, Garcia scores were assessed at various time points post‐MCAO (3rd, 6th, 12th, 24th, and 48th hour). A significant reduction in Garcia scores was observed in the young‐MCAO group compared to the young‐sham group, with the decline becoming more pronounced over time (p < 0.01) (Figure 1A). Similarly, the aged‐MCAO group exhibited significantly lower Garcia scores than the aged‐sham group at all time points (p < 0.01) (Figure 1B). By the 48th hour, the reduction in Garcia scores was more pronounced in the aged‐MCAO group compared to the young‐MCAO group, indicating more severe neurological deficits in aged rats. These findings suggest that the extent of neurological damage worsens over time post‐ischemia and that aged rats experience more severe deficits.

TTC staining was used to visualize brain infarcts. There were no infarcts in the young‐sham and aged‐sham groups, while significant infarcts were observed in both MCAO groups (Figure 1C). In the young‐MCAO group, IAs increased with reperfusion time, peaking at the 48th hour (p < 0.01) (Figure 1E). Similarly, the aged‐MCAO group exhibited a significant increase in infarcts size over time compared to the aged‐sham group (p < 0.01) (Figure 1D,F). These findings suggested that brain tissue damage progressively worsens post‐ischemia, with aged rats experiencing larger IAs than younger rats.

Pearson correlation coefficient analysis revealed a strong negative correlation between Garcia scores and infarct percentage in both young (r = −0.912, p < 0.001) and aged rats (r = −0.946, p < 0.001) (Figure 2), indicating that larger IAs were associated with more severe neurological deficit. This suggested a direct relationship between brain infarction and functional impairment in IS rats.

Changes in melatonin and cortisol levels in the serum of rats were detected using ELISA. The results showed that melatonin levels in the young‐MCAO group were significantly lower than in the young‐sham group at multiple time points (2d‐18 h, 2d‐24 h, 3d‐18 h, 3d‐24 h, 5d‐18 h, and 7d‐12 h) (p < 0.01), with the most notable reductions occurring in the evening hours (Figure 3A). In the aged rats, the aged‐MCAO group had significantly lower melatonin levels than the aged‐sham group at nearly all time points (p < 0.01), with the most pronounced reduction observed at 18 h on days 2, 3, 5, and 7 (Figure 3B).

Cortisol levels were also assessed, revealing a complex pattern. In the young‐MCAO group, cortisol levels were lower than in the young‐sham group at 2d‐12 h and 3d‐12 h but were higher at 5d‐12 h and 7d‐12 h (p < 0.01) (Figure 3C). In the aged rats, the aged‐MCAO group showed consistently higher cortisol levels than the aged‐sham group at all time points, particularly during the night and morning (p < 0.01) (Figure 3D).

These results indicated that IS caused a substantial disruption in melatonin levels and cortisol rhythms, with aged rats showing more pronounced and severe disturbances.

To assess the impact of sleep deprivation on IS recovery, rats were subjected to sleep deprivation, and NREM sleep frequency and theta power were observed and recorded at the 2nd, 4th, and 6th hour. The results showed that compared to the rats in the young‐sham‐sleep deprivation group, NREM sleep frequency and theta power significantly decreased at the 6th hour in the young‐MCAO‐sleep deprivation group (p < 0.01) (Figure 5A). A similar trend was observed in the aged rats (p < 0.01) (Figure 5B). These results suggest that sleep deprivation exacerbates sleep disturbances in IS rats, further impairing the sleep–wake cycle.

Following sleep deprivation, rats were allowed a recovery period, and sleep parameters were recorded at the 2nd, 4th, and 6th hours. In the young‐MCAO‐recovery group, sleep latency and waking time slightly increased, while NREM and REM sleep significantly decreased compared to the young‐sham‐recovery group (p < 0.05) (Figure 5C). Similarly, compared to the aged‐sham‐recovery group, the aged‐MCAO‐recovery group also showed a slight increase in sleep latency and waking time, with NREM and REM showing varying degrees of reduction (Figure 5D). These findings indicated that IS impaired the ability to recover sleep after deprivation.

RT‐qPCR was used to detect the mRNA expression of Per1 and Cry1 in the pineal gland at days 2, 3, 5, and 7 post‐MCAO. In the young‐MCAO group, Per1 expression was significantly elevated at 12th and 18th on days 2 and 3 compared to the young‐sham group (p < 0.01) (Figure 6A). Besides, the mRNA expression of Cry1 was significantly elevated at 12th on day 2 (p < 0.01) (Figure 6B). The aged‐MCAO group also showed significant increases in Per1 expression at multiple time points (2d‐12 h, 2d‐18 h, 3d‐12 h, 3d‐18 h, 5d‐12 h, and 7d‐12 h) (p < 0.01) (Figure 6C), with Cry1 levels elevated at 2d‐12 h and 5d‐24 h (p < 0.01) (Figure 6D). The above results indicated that the IS altered the expression of key circadian genes, contributing to disruptions in circadian rhythms.

As shown in Figure 7, western blot results revealed that Per1 protein levels were significantly elevated at 2d‐12 h, 2d‐18 h, and 3d‐12 h (p < 0.01), and Cry1 levels were significantly elevated at 12th hour on day 2 (p < 0.01). Similar increases were observed in aged rats, with Per1 (2d‐12 h, 2d‐18 h, 3d‐12 h, 3d‐18 h, 5d‐12 h, and 7d‐12 h) and Cry1 (2d‐12 h, 3d‐12 h, and 5d‐24 h) protein levels significantly elevated at multiple time points (p < 0.01). These results indicated that IS altered the expression of key circadian proteins, which likely contributed to the observed disruptions in the sleep–wake cycle.

The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.