Virology journal

Rapid detection of swine flu and pig reproductive respiratory syndrome using a CRISPR-based dual test

Updated

Abstract

The dual-detection platform achieved detection limits of 5 copies/µL for swine influenza virus (SIV) and 2 copies/µL for porcine reproductive and respiratory syndrome virus (PRRSV).

  • The assay integrates reverse transcription loop-mediated isothermal amplification with CRISPR technology for enhanced detection.
  • A 20-minute amplification process at 40 °C is followed by a 5-minute readout using lateral flow dipstick visualization.
  • High specificity was observed against other common swine pathogens during testing.
  • Preliminary validation with respiratory infection samples showed high concordance with existing reference methods.

Simplified

Full Text

Introduction

Swine influenza (SI) is a highly pathogenic respiratory disease that primarily affects pigs, with the main clinical subtypes including H1N1, H1N2, and H3N2. The swine influenza virus (SIV), a member of the Orthomyxoviridae family, has a genome composed of eight negative-sense single-stranded RNA segments, encoding 20 viral proteins. Its virions exhibit a spherical morphology (80–120 nm in diameter) or filamentous morphology [1, 2]. Since Shope first isolated the first SIV strain from pigs in 1931 and preliminarily characterized its biological properties and transmission mechanisms [3], SI has gradually spread globally and become one of the most prevalent infectious diseases in pig populations, causing substantial economic losses to the swine industry annually.

Porcine Reproductive and Respiratory Syndrome Virus (PRRSV) is an enveloped, positive-sense single-stranded RNA virus of the genus Arterivirus, with a genome of approximately 15 kb [4]. First identified in the United States in 1987, PRRSV has since been reported in Canada, Japan, Germany, the Netherlands, and other countries worldwide. It is genetically classified into two distinct genotypes: PRRSV-1 (European type) and PRRSV-2 (North American type). PRRSV exhibits broad tissue tropism in pigs, replicating in multiple organs including the intestine, liver, lungs, spleen, kidneys, blood, and reproductive tissues. Infection with highly pathogenic PRRSV (HP-PRRSV) significantly up regulates the secretion of pro-inflammatory cytokines such as TNF-α, IL-1β, and IL-6, leading to depletion of pulmonary immune cells [57], enhanced cell death, and dysregulation of the respiratory immune response. These pathological changes render infected pigs more susceptible to secondary opportunistic infections, further exacerbating disease severity [8, 9].

Notably, SI and porcine reproductive and respiratory syndrome (PRRS) share remarkably similar clinical manifestations, including coughing, sneezing, dyspnea, and tachypnea, accompanied by systemic symptoms such as fever, lethargy, and anorexia [10, 11]. This clinical overlap makes it difficult to differentiate between the two pathogens based solely on clinical signs. Furthermore, both viruses are transmitted primarily through direct contact and aerosol routes, which facilitates their rapid spread in intensive pig farming systems [12, 13].

Co-infection with SIV and PRRSV is frequently observed in both herds and individual pigs, and their synergistic effects (e.g., immunosuppression and enhanced secondary infection risk) significantly increase clinical severity and mortality. For example, PRRSV infection damages alveolar macrophages in pigs, while SIV primarily attacks respiratory mucosa; their synergistic effects may exacerbate respiratory disease progression. Research on mixed infections of these two viruses was first reported as early as 1996. The result indicated that mixed infections exhibited more severe clinical symptoms and poorer prognosis than single infections [14]. In a survey involving 636 SIV-positive cases, 109 PRRSV-positive samples were detected, yielding a mixed infection rate of 17% [15]. Experiments by Pol et al. indicated that bronchitis was more severe in the PRRSV and SIV co-infection group than in the single infection group, and that PRRSV did not affect SIV replication [16]. Early detection and diagnosis of pathogens and control of adverse consequences of infection are essential measures. Accurately detecting SIV and PRRSV co infections is crucial for effective management and reducing the burden of economic losses.

Current methods for detecting SIV and PRRSV include droplet digital PCR (ddPCR) [17], real-time quantitative reverse transcription PCR (RT-qPCR) [18], isothermal amplification (e.g., LAMP) [19], enzyme-linked immunosorbent assay (ELISA) [20], and colloidal gold immunochromatography assay (GICA) [21]. However, these methods have notable limitations: they rely on specialized laboratory equipment, involve complex operational steps, and require well-trained technicians. These constraints greatly limit their application in on-site settings such as pig farms, where rapid and simple virus detection is urgently needed.

It is essential to develop a detection method for the rapid screening of SIV and PRRSV that requires minimal reagents, does not necessitate specialized equipment, exhibits high sensitivity, and is amenable to future on-site application in livestock farms. The Cas protein family possesses significant capabilities and developmental potential in gene editing and pathogen detection, particularly effector proteins such as Cas12a and Cas13a, which exhibit both cis- and trans-cleavage activities. While these proteins efficiently and specifically cleave target sequences, they can also cleave non-specific sequences within the system, a critical requirement for effective pathogen detection [22, 23]. The CRISPR-Cas system marks a revolutionary advancement over traditional pathogen detection technologies, offering a powerful tool for early pathogen identification and diagnosis. Through cis-cleavage and the supplementary induction of guide RNA (gRNA), it demonstrates highly efficient specific cleavage activity and can be employed for the detection of pathogenic genes across various diseases. LAMP isothermal amplification technology, known for its excellent sensitivity and simplicity, has been widely utilized for the rapid detection of numerous diseases. However, reliance on a single detection method may lead to the possibility of false positives [24].

Based on the above considerations, our research team innovatively integrated LAMP isothermal amplification technology with the trans-cleavage activity of the CRISPR-Cas12a/13a system to establish a rapid detection method for SIV and PRRSV. This method is characterized by simple operation, high sensitivity, and strong specificity, and enables visual detection of SIV and PRRSV through colorimetric changes on lateral-flow dipsticks. This system offers a potential tool for the on-site screening of SIV and PRRSV in resource-limited settings. Its application may support earlier clinical diagnosis and targeted disease prevention, thereby aiding control efforts in the swine industry.

Materials and methods

Sample collection and identification

A total of 2,296 swine fecal and nasal swabs, routinely collected once per month in 2021, were kindly provided by four pig farms in Shenyang, Liaoning Province. These farms included both nursery-finish and farrow-to-finish operations.

Total RNA was extracted from the samples using the TRIzol method. RT-PCR amplification of (Nucleoprotein) NP gene and matrix (M) gene in SIV using HiScript ® II One Step RT-PCR Kit (Q611-01, Vazyme, Nanjing, China) for the selection of positive samples [25]. After downloading multiple SIV HA gene sequences and PRRSV ORF6 gene sequences from the GenBank database, we followed previous methods to align the sequences using MEGA 11 and designed strain-specific primers for different types of strains using Primer 5.0 software [2628]. Positive samples and ddH₂O were used as controls in each run, The subtype was determined based on the Cq value and melting curve of each sample. RT-qPCR reaction using HiScript ® II One Step RT-qPCR SYBR kit (Q221-01, Vazyme, Nanjing, China) to identify SIV and PRRSV subtypes, follow the manufacturer’s instructions. The relevant primers involved are shown in Tables S1 and S2. Primers were synthesized by Sheng gong Biotech (Shanghai) Co., Ltd. Through this RT-qPCR detection, we have determined the overall positive rate of SIV and provided a preliminary positive sample library for subsequent subtype analysis (Table S5) and validation of the new method.

Design of SIV and PRRSV RT-LAMP primers and establishment of amplification methods

RT-LAMP primers consist of two external primers (F3 and B3) and two internal primers (forward internal primer [FIP] and backward internal primer [BIP]). Primer design was performed using the LAMP Primer Online Design Website (http://primerexplorer.jp/e/) for the SIV-M gene sequence and the PRRSV-ORF6 gene sequence, respectively (Table 1). Subsequently, the most effective primers were selected while ensuring no cross-reactivity between the SIV-M and PRRSV-ORF6 detection systems. A temperature gradient ranging from 20 °C to 80 °C was established for the LAMP reaction, with a corresponding time gradient of 20–80 min. Determination of the optimal reaction temperature and time was performed by analyzing the results with SYBR Green I staining and agarose gel electrophoresis.

The LAMP assay was conducted in a 25 µL final reaction volume, consisting of 5 µL 10× Isothermal Amplification Buffer (NEB, M0374), 6 mM MgSO₄ (100 mM) (NEB, M0374), 1.4 mM dNTP Mix (10 mM) (Thermo Fisher Scientific, R0192), 0.2 µM each of F3/B3 primers (25×), 1.6 µM each of FIP/BIP primers (25×), 1 µL Bst 3.0 DNA polymerase(NEB, M0374), 2 µL DNA template (100 ng/µL positive plasmid), and ddH₂O to bring the volume to 25 µL. For initial primer screening, amplification was performed at 60 °C for 1 h. Subsequent optimization established 40 °C for 20 min as the standard condition for the final assay (see Results 3.1). RNase-free ddH₂O served as a blank control, and neutral red dye was added for visual interpretation.

Primer sequences for loop-mediated isothermal amplification (LAMP)
PrimerSequence (5´→3´)
1SIV-M-F3 1SIV-M-B3TCTAGTATGTGCCACTTG TGTACCATCTGCCTAGT
1SIV-M-FIPTAGCCAGCACCATTCTGTCATCGATCTCACAGACAA
1SIV-M-BIPTATGGAACAGATGGCTGGATTTGATTAGCTACCTCCATG
2SIV-M-F3ACAGAAGCTGCATTTGGTCT
2SIV-M-B3GCTACCTCCATGGCCTCT
2SIV-M-FIPCGGATTGGTGGTGGTAGCCATTGCCACTTGTGAACAGATTGC
2SIV-M-BIPAATGGTGCTGGCTAGCACTACGCTGCCTGTTCACTCGATCC
3SIV-M-F3TCTAGTATGTGCCACTTG
3SIV-M-B3CACTGGAACTAGGATGAG
3SIV-M-FIPATCCAGCCATCTGTTCCATAACCAATCCGCTAATCAG
3SIV-M-BIPAGTGAACAGGCAGCAGATGTACCATCTGCCTAGT
4SIV-M-F3ACAACATGGATAGAGCAG
4SIV-M-B3CTGATTAGCGGATTGGT
4SIV-M-FIPCCATCCTGTTGTATATGAGGCGTCACTAAGCTATTCAACTG
4SIV-M-BIPGAACAGTGACCACAGAAGCCTGTGAATCAGCAATCTG
1PRRSV-ORF6-F3TAATACGACTCACTATAGAATGATAGCACAGCCCCAC

Establishment of rapid detection methods for SIV and PRRSV based on CRISPR-Cas12a/13a technology

Design primers for constructing a PRRSV-ORF6 positive control (Table S1). Subsequently, extract genomic RNA from the PRRSV TJM-F92 (Genus: Betaarterivirus, Species: Porcine reproductive and respiratory syndrome virus) strain (Qingdao Yibang Bioengineering Co., Ltd.) using the Fast Pure Viral DNA/RNA Mini Kit (Tiangen Biochemical Technology Co., Ltd) following the manufacturer’s instructions. The ORF6 fragment was homologously recombined with the digested vector using the Clon Express II Kit (37 °C, 30 min) and then transformed into E. coli DH5α competent cells. Positive recombinant plasmids were identified by colony PCR (primers M13-F/ORF6-R) and were verified by sequencing (performed by Shengong Bioengineering Co., Ltd.). The sequencing results are provided in the Supplementary Material (Figure S1).

Based on Cas12a/13a cleavage preferences, fluorescent quenched ssDNA reporter genes were designed as 5′- FAM -TTAT- BHQ1-3′ and 5′-FAM-UU-BHQ1-3′. Fluorescence generation was detected via CRISPR-Cas12a/13a cleavage to screen cRNAs and optimize Cas12a/13a protein concentration. CRISPR-Cas12a (Cpf1) and CRISPR-Cas13a were both purchased from Guangzhou Meige Biotechnology Co., Ltd(Sealed and stored at −20 ℃ away from light).

The 50 µL CRISPR/Cas12a/Cas13a cleavage reaction system is listed in Table S4. Cas12a/13a-crRNA and nuclease was optimized in the range of 10 to 40 nM or12 nM to 48 nM as working concentrations. SIV LAMP and PRRSV LAMP products, Mycoplasma hyopneumoniae (Mhp), Pseudorabies virus (PRV), Classical Swine Fever virus (CSFV), and Pasteurella multocida (Pm)vaccine strains (ddH₂O as negative control) were used to measure specificity (the Mhp vaccine strain from Qian yuan hao Bio Co., Ltd., the PRV vaccine strain from Pulike Bioengineering Co., Ltd., the CSFV vaccine strain from Harbin Pharmaceutical Group Biological Vaccine Co., Ltd., and the Pm vaccine strain from Pan shi Yi ge Biotechnology Development Co., Ltd.). In the sensitivity experiment to determine the detection limit (LOD), the matrix we used was a standard positive plasmid that had been diluted tenfold, transcribed or cloned in vitro. SIV-M-pCAGGS positive plasmid (6.11 × 105~2 copies/µL) as a template, In vitro transcribed RNA of PRRSV-ORF6-pUC19 positive plasmid (1.03 × 105~2 copies/µL) as a template.The system was placed in a real-time fluorescence quantitative PCR instrument (Thermo Fisher Scientific QuantStudio 5), with real-time fluorescence intensity detected and endpoint fluorescence intensity read at 40 °C (FAM channel, Ex/Em:492/518 nm). Alternatively, the reaction products were placed under blue light (GIS-2020 Gel Imaging System) for naked-eye observation and photography. Normalization of fluorescence intensity using blank control background subtraction and repeated calibration techniques.

To evaluate the ability of the established RT-LAMP-CRISPR-LFD dual detection method for SIV and PRRSV to detect these viruses in clinical specimens, we selected 21 mixed infection swab samples and other specimens tested by qPCR and RT-PCR. The LAMP amplification product (10 µL total volume) of clinical samples was mixed with the CRISPR-Cas12a/13a system for digestion, followed by incubation in a PCR tube for 5 min before result observation (reaction system and conditions are detailed in Table S5). The CRISPR dual enzyme side flow test strip (LFD) was purchased from Beijing Baoying Tonghui Biotechnology Co., Ltd. Probe A, targeting SIV, is biotinylated at one end and FAM-labeled at the other (sequence: 5′-Biotin-TTATT-FAM-3′); Probe B, targeting PRRSV, is biotinylated at one end and DIG-labeled at the other (sequence: 5′-Biotin-UUUUUUUUUU-DIG-3′). The fluorescent probe was synthesized in the form of primers by Biotechnology (Shanghai) Co., Ltd (Store in a dark and dry place at −20 ℃). Test line T1 is coated with a FAM-specific antibody, Test line T2 (for PRRSV detection) is coated with a DIG-specific antibody, and Control line C is coated with a biotin-specific antibody. The detection principle is shown in Fig. 1A.

For samples displaying weak bands, immediately repeat the RT-LAMP-CRISPR-LFD assay using the same batch of LFD reagent and newly extracted sample RNA. If the weak band disappears after retesting, the sample is considered ‘negative’. If the weak band persists, use gold standard RT-PCR for targeted amplification assessment(Primer sequences in Table S1; The reaction system follows HiScript ® II. Instructions for One Step RT-PCR Kit).

Establishment of CRISPR/Cas12a/13a Detection Platform for SIV and PRRSV. () LFD result interpretation guide; () SIV LAMP reaction temperature screening; () SIV LAMP reaction time screening; () PRRSV LAMP reaction temperature screening; () PRRSV LAMP reaction time screening; () Investigation of CRISPR-Cas12a specificity; () Investigation of CRISPR-Cas13a specificity; () Determination of the detection limit for SIV using the CRISPR-Cas12a system. The assay achieved a detection limit of 5 copies/µL.() Determination of the detection limit for PRRSV using the CRISPR-Cas13a system. The detection limit was determined to be 2 copies/µL. NTC, Nontarget control. The sensitivity and specificity evaluation results of CRISPR/Cas12a/13a detection were shown by the endpoint fluorescence intensity and endpoint fluorescence photography. Each experiment was performed in triplicate (= 3), Data were expressed as mean ± SD (= 3 technical replicates). All data were compared with NTC for significant difference. ∗≤ 0.05 A B C D E F G H I n n P

Statistical analysis

Data analysis was performed utilizing GraphPad Prism 9.0. Results from assay optimization trials are shown as the mean ± standard deviation of three independent technical replicates. Statistical variances were assessed employing the t-test, with significance defined as P < 0.05. Diagnostic accuracy (sensitivity, specificity, PPV, NPV with 95% CI) and inter-method agreement (Cohen’s κ) were determined against RT-PCR using a 2 × 2 contingency table.

Results

Establishment of SIV and PRRSV RT-LAMP detection platform

Using the SIV-M plasmid and the PRRSV-ORF6-pUC19 plasmid as templates, nine pairs of LAMP primers were designed and screened, with each primer pair utilizing RNase-free ddH₂O as a negative control. The band corresponding to primer 4 exhibited the brightest and clearest signal in both systems, leading to its selection for subsequent experiments (Fig. S2A, B). To optimize the LAMP assay conditions, reaction temperatures were set at 20 °C, 30 °C, 40 °C, 50 °C, 60 °C, 70 °C, and 80 °C, while reaction times were established at 20 min, 30 min, 40 min, 50 min, 60 min, 70 min, and 80 min (Fig. 1A, B, C, D). All temperature and time groups demonstrated target band formation and positive fluorescence signals, indicating that the established LAMP assay possesses a broad applicable temperature range and is time-flexible. Based on the temperature gradient results, 40 °C was selected as the optimal amplification temperature, as it provided robust amplification efficiency while minimizing non-specific products. Combined with a 20-minute reaction time, this condition also supports feasible on-site implementation using simple heating devices. These parameters were used in all subsequent experiments.

Establishment of RT-LAMP-CRISPR/Cas12a/13a detection platform for SIV and PRRSV

To improve the sensitivity and specificity of loop-mediated isothermal amplification (LAMP) technology, we integrated it with CRISPR-Cas12a/13a systems. We designed crRNAs targeting conserved regions of swine influenza virus (SIV) and porcine reproductive and respiratory syndrome virus (PRRSV), and synthesized dual-fluorescent probes. For Cas12a’s ssDNA cleavage activity, the FAM-TATT-BHQ1 DNA reporter molecule (Ex/Em: 492/518 nm) was designed; for Cas13a’s ssRNA cleavage activity, the FAM-UUUUUUUUU-BHQ1 RNA reporter molecule was designed.Set the reaction temperature to 40 ℃ and read the fluorescence value every 1 min for a total of 60 cycles. Using LAMP amplification products as templates, we optimized the CRISPR-Cas12a/13a detection system and assessed its performance. Given the critical role of crRNA concentration in cleavage efficiency, we tested a gradient ranging from 10 to 50 nM. The results indicated that the highest fluorescence intensity was achieved at a crRNA concentration of 40 nM. At 20 nM crRNA, the final fluorescence values reached 4 M for SIV and 500 K for PRRSV, respectively (Fig. S2C, E). Further optimization of Cas12a/13a protein concentrations revealed that fluorescence intensities exceeded 4 M when the Cas12a concentration was ≥ 36 nM for SIV detection, and surpassed 600 K when the Cas13a concentration was ≥ 24 nM for PRRSV detection (Fig. S2D, F). After balancing signal intensity and cost-efficiency, we adopted 20 nM crRNA as the standard concentration, with 36 nM Cas12a and 24 nM Cas13a designated as the optimal working concentrations for subsequent experiments.

Specificity assessment of RT-LAMP-CRISPR/Cas12a/13a detection platform for SIV and PRRSV

We employed the LAMP-CRISPR/Cas12a/13a detection platform to screen nucleic acids from SIV, PRRSV, Mhp, PRV, CSFV, and Pm samples. The qPCR instrument detected fluorescence signals exclusively in the SIV and PRRSV groups, with no signals observed in the other groups (Fig. 1E, F). Following the reaction, the tubes were visualized using the GIS-2020 Gel Imaging System, which revealed distinct fluorescence exclusively in the SIV and PRRSV groups. These results demonstrate the excellent specificity of the method.

Sensitivity assessment of RT-LAMP-CRISPR/Cas12a/13a detection platform for SIV and PRRSV

The laboratory-stored SIV-M-pCAGGS standard positive plasmid, along with amplification products generated using the 2PRRSV-ORF6-F3 and 2PRRSV-ORF6-B3 primers, were subjected to tenfold serial dilutions. The method successfully detected viral concentrations as low as 5 copies/µL (for SIV) and 2 copies/µL (for PRRSV) (Fig. 1-G, H). These results demonstrate the excellent sensitivity of the method.

Detection of clinical specimens by CRISPR/Cas12a/13a assay

We monitored respiratory viruses in local pig herds in Shenyang, Liaoning Province, a prominent pig farming region in Northeast China, throughout 2021. We collected a total of 2,296 swab samples from four representative pig farms, which included two fattening farms and two self-breeding farms, and conducted tests for SIV and PRRSV on these samples. To verify the reliability of this method, we selected 21 clinical samples that were preliminarily screened by RT-qPCR and finally confirmed by RT-PCR (including SIV single positive, PRRSV single positive, co infected, and negative samples) for targeted detection. Notably, 11 samples were identified as co-infected, indicating positivity for both viruses. The established LAMP-CRISPR-LFD method and RT-PCR were used for parallel detection of SIV and PRRSV in these samples, and the results were compared (Tables 2 and 3). The results indicated that, compared to RT-PCR, the LAMP-CRISPR-LFD method yielded identical detection outcomes for SIV and PRRSV (Fig. 2). These findings suggest that the LAMP-CRISPR-LFD method holds promise for rapid clinical screening. Additionally, we conducted subtype identification on the SIV and PRRSV positive samples, with the results presented in Table S5.

SIV and PRRSV clinical sample test results () SIV LFD; () PRRSV LFD; () Co-infection sample LFD; () SIV RT-PCR; () PRRSV RT-PCR; M: marker A B C D E

Infection of clinical samples
NumberVirus 123456789101112131415161718192021
SIV+++++++++++-+-+++++-+
PRRSV++-+--++++-+-+-++++--
Mixed Infection++-+--++++-----+++---
Comparison between LAMP-CRISPR-Cas-LFD detection method and RT-PCR method
RT-PCR
PositiveNegativeIn totalSensitivitySpecificity
LAMP-CRISPR-Cas-LFD SIVPositive Negative In total18 3 213 18 2121100%100%
LAMP-CRISPR- Cas-LFD PRRSVPositive Negative In total13 8 218 13 2121100%100%

Discussion

Clinically, SIV-PRRSV co-infection is widely documented to exacerbate disease severity in swine herds, increasing lung lesion scores and impairing host immunity [2932]. This underscores the need for rapid, accurate diagnostic tools. Current methods like RT-PCR and RT-qPCR, however, are often time-consuming and equipment-dependent, limiting their use in field settings. As the world’s largest producer and trader of pigs, China’s swine industry is in a critical phase of large-scale, intensive development [33]. Its increasingly close trade links with the international market for pigs and related products have elevated the risk of outbreaks and transmission of respiratory viruses in pig herds. As a major pig-producing province in Northeast China, Liaoning’s swine health status exerts a significant impact on the stability of both the regional and national swine industries. Therefore, this study first performed swine influenza virus (SIV) detection on 2,296 swine nasal swabs and fecal samples samples collected from Shenyang, Liaoning Province, China, in 2021. It is worth noting that pathogen detection is concentrated on nasal swabs, so we also advocate for the future use of this method for virus detection by only collecting nasal swabs from pig herds.

The overall SIV detection rate was 3.6%, with Eurasian avian-like (EA) H1N1 and 2009 pandemic (pdm) H1N1 strains remaining the predominant subtypes. This result is consistent with findings from previous investigations in the region [25]. Clinically, SIV-PRRSV co-infection is widely documented to exacerbate disease severity in swine herds—this interaction not only increases lung lesion scores but also impairs host antiviral immunity, leading to prolonged viral shedding and higher secondary bacterial infection rates. A systematic review of PRRSV co-infection studies confirmed that such dual infections are a key contributor to porcine respiratory disease complex outbreaks, with particularly severe consequences in weaned piglets [13].

At present, the detection methods for SIV and PRRSV are mainly RT-PCR and RT-qPCR. RT-PCR detection takes up to 1–3 h, and the sensitivity is low if the detection time is too long [34, 35]; RT-qPCR can display detection results within 1 h, but the detection cost is high and it is not suitable for rapid detection in pig farms with limited laboratory resources [36].

The M gene of SIV and the ORF6 gene of PRRSV, as structural proteins of two pathogens, are highly conserved in viral evolution and are ideal targets for detecting these two pathogens [37, 38]. This study designed LAMP primers based on the aforementioned genes and combined them with the CRISPR-Cas12a/13a system, mainly utilizing the trans cleavage activity of two proteins to design crRNAs that strictly match the target sequence. When crRNA binds to the target sequence, 95% complementarity is required to activate the cleavage activity of Cas12a/13a, thereby indiscriminately cleaving ssDNA and ssRNA fluorescent probes in the system. FAM fluorescent groups are released to generate fluorescent signals.

To address the false-positive issue associated with traditional LAMP, we established a dual-target detection platform by integrating RT-LAMP with orthogonal CRISPR-Cas12a/13a and LFD readout. This assay simultaneously detects SIV and PRRSV with high sensitivity (5 and 2 copies/µL, respectively) within 40 min. The speed, simplicity, and minimal equipment requirements provide a foundation for its potential use in field settings such as breeding farms for rapid screening. In clinical validation, the platform showed complete concordance with reference RT-PCR assays (Fig. 2; Table 2), demonstrating its technical feasibility for detecting these pathogens in relevant samples. The mixed infection rate of SIV and PRRSV in this study, while not notably high, may be influenced by regional and seasonal variations, as well as the diversity of pig breeds within the herd. This disparity underscores the substantial heterogeneity and regional specificity in the epidemiological features of respiratory virus co-infections. Subsequent investigations should consider incorporating local prevalent strain profiles, host immune responses, and employing multi-point sampling approaches to enhance the precision of assessments.

In comparison to performing two distinct single-virus tests, LAMP-CRISPR-LFD platform minimizes sample processing, operational steps, and overall testing time by 50%. This approach can substantially enhance screening efficiency and lower testing costs when a rapid response is required during an epidemic. Despite these significant achievements, the current system requires optimization in several areas: 1. Viral strain variability: Although our primers and crRNAs are meticulously designed for the highly conserved regions of two viruses, it is essential to consider the broader variability among viral strains. Given the propensity for mutations in circulating respiratory viruses and the high base specificity of the CRISPR/Cas system, we advocate for the incorporation of sequencing technology as a supplementary method. This approach will facilitate continuous monitoring of changes in pathogen sequences and allow for the dynamic redesign of CRISPR/Cas primers and crRNAs. 2.Grassroots testers often lack a professional experimental background, which can lead to incorrect results due to improper handling. To address this issue, we are actively developing a “one-step premixing kit” that combines all reaction components in a single test tube; only 5 µL of sample RNA needs to be added to initiate the reaction, thereby reducing operational steps. Key components, such as Bst DNA polymerase, Cas12a/Cas13a proteins, and crRNA, can be processed into dry powder through freeze-drying technology, enabling transportation and storage at room temperature while minimizing reliance on and costs associated with cold chain logistics. Additionally, we plan to develop a “Visual Operation Manual” and create a “5-minute short video training course.” 3. Future research should focus on developing more effective methods for extracting viral genes to reduce adverse effects on on-site sample detection.

Conclusion

The RT-LAMP-CRISPR-Cas12a/13a-LFD assay developed in this study demonstrates exceptional sensitivity and specificity for detecting SIV and PRRSV, with good potential for field applicability. The isothermal conditions required for this assay can be easily achieved using a basic heating device such as a water bath set at 40 °C, making it suitable for resource-limited settings like small-scale pig farms and field testing locations. In comparison to RT-PCR and RT-qPCR, which necessitate complex equipment, high expenses, and lengthy processing times, this assay’s simplicity, speed, and minimal equipment requirements render it a more practical choice for simultaneous detection of both viruses. This method represents a straightforward, effective, and cost-efficient approach for early screening, clinical diagnosis, and epidemiological monitoring of SIV and PRRSV, offering substantial support for precise disease prevention and management in swine production systems.

Supplementary Information

Author contributions

SCG: Conceptualization; Data curation; Writing - original draft. SYCZ and SQT: Conceptualization; Data curation. HYL, YNW, WL and SQX: Formal analysis; Validation. YLF: Writing - Review & Editing. YZ: Supervision; Grant funding; Writing - Review & Editing.

Funding

This research was financed by the National Key Research and Development Program of China (2021YFD1800200) and the National Natural Science Foundation of China (32170539, 32570623).

Data availability

The datasets generated and analyzed during the current study, including the detailed protocols, are available from the corresponding author upon reasonable request. The primer and crRNA sequences are clearly listed within the article.

Declarations

Ethics approval and consent to participate

This work complied with all relevant ethical guidelines and did not involve the use of experimental animals. All samples were exclusively sourced from existing surveillance infrastructure; specifically, porcine swabs were collected as part of routine pathogen monitoring programs in multiple swine farms and supplied by the farms’ own diagnostic laboratories.

Consent for publication

Not applicable.

Competing interests

The authors declare no competing interests.

Footnotes

References

Associated Data

Supplementary Materials

Data Availability Statement

The datasets generated and analyzed during the current study, including the detailed protocols, are available from the corresponding author upon reasonable request. The primer and crRNA sequences are clearly listed within the article.

Funding

Competing interests

Declarations. Ethics approval and consent to participate: This work complied with all relevant ethical guidelines and did not involve the use of experimental animals. All samples were exclusively sourced from existing surveillance infrastructure; specifically, porcine swabs were collected as part of routine pathogen monitoring programs in multiple swine farms and supplied by the farms’ own diagnostic laboratories. Consent for publication: Not applicable. Competing interests: The authors declare no competing interests.
PubMed

What Lands in Your Inbox Each Week:

  • 📚7 fresh studies
  • 📝plain-language summaries
  • direct links to original studies
  • 🏅top journal indicators
  • 📅weekly delivery
  • 🧘‍♂️always free