Consolidation and maintenance of long-term memory involve dual functions of the developmental regulator Apterous in clock neurons and mushroom bodies in the Drosophila brain

We examined whether Ap is involved in Drosophila memory using a courtship conditioning assay. In this assay, 1-hour conditioning generates short-term memory (STM), and 7-hour conditioning induces LTM [4,30,31]. STM persists for at least 1 hour, whereas LTM persists for at least 5 days [4,31]. Two mutant alleles of ap (ap^rk568 and ap^UGO35) were tested for the effects of ap mutations on LTM. ap^rk568 is a strong hypomorphic allele with a P element insertion into the putative 5′-flanking region [18]. ap^UGO35 (hereafter referred to as ap^null) is a null allele generated by the imprecise excision of the P element associated with ap^rk568 [18]. Since ap^rk568 and ap^null are homozygous lethal, we used heterozygous mutants (ap^rk568/+ and ap^null/+). In wild-type (WT), ap^rk568/+, and ap^null/+ flies, the courtship index (CI), an indicator of male courtship activity, of conditioned males was significantly lower than that of naive males 1 hour after 1-hour conditioning (Fig 1A, CI). To quantify courtship memory, memory index (MI) was calculated (refer to Materials and Methods). No significant differences in MI were detected among 3 genotypes (Fig 1A, MI; WT versusap^rk568/+, Permutation test; P = 0.550; WT versus ap^null/+, Permutation test; P = 0.896). Thus, in ap^rk568/+ and ap^null/+, 1-hour memory was intact. Furthermore, we examined whether male courtship suppression is detected 8 hours and 24 hours after 1-hour conditioning. The courtship suppression of conditioned males was evident in WT and ap^rk568/+ flies 8 hours after 1-hour conditioning (S1 Fig), whereas it was not detected 24 hours after 1-hour conditioning. These results demonstrate that courtship STM is maintained for at least 8 hours and that the ability of heterozygous ap^rk568 flies to learn, form, and maintain STM is comparable to that of WT flies.

On day 5 after 7-hour conditioning (hereafter referred to as 5-day memory), WT flies also showed a significant reduction in CI in a conditioning-dependent manner (Fig 1B, CI). However, no significant differences in CI were detected between naive and conditioned ap^rk568/+ and ap^null/+ (Fig 1B, CI), and their LTM was impaired (Fig 1B, MI; WT versus ap^rk568/+, Permutation test; P = 0.004; WT versus ap^null/+, Permutation test; P = 0.015), indicating that Ap is essential for LTM specifically.

Since Ap plays essential roles in neurodevelopmental events in the central nervous system [17], it is possible that the observed LTM impairment is caused by neurodevelopmental defects in ap mutant flies. To determine if the ap expression in adulthood is critical for LTM, we examined the effects of temporal knockdown of ap expression on the LTM phenotype using flies heterozygous for heat-shock (hs)-GAL4 and UAS-ap RNA interference (RNAi) lines (hs-GAL4/UAS-ap RNAi). First, the effectiveness of ap RNAi was confirmed by quantitative reverse transcription PCR (qRT-PCR). Flies were heat-shocked (37°C) for 20 minutes, and total RNA was extracted 3 hours after heat-shock treatment. Heat-shocked hs-GAL4/UAS-ap RNAi flies showed about 50% reduction in ap expression level compared with control flies (Fig 1C; hs-GAL4/+, Student t test, t₍₈₎ = −1.474, P = 2.306; +/UAS-ap RNAi, U = 5, P = 0.117; hs-GAL4/UAS-ap RNAi, U = 4, P = 0.025). The ap expression level recovered to the non–heat-shocked level 48 hours after heat-shock treatment (S2 Fig). In the absence of heat-shock treatment, LTM in hs-GAL4/UAS-ap RNAi flies was detected [Fig 1D–1F; CI in HS− (1), U = 240, P = 0.002; CI in HS− (2), U = 206.5, P = 0.002; CI in HS− (3), U = 220, P = 0.004]. By contrast, LTM impairment was observed when flies were heat-shocked 3 hours before or immediately after 7-hour conditioning (Fig 1D and 1E; HS− versus HS+(1), Permutation test; P = 0.037; HS− versus HS+(2), Permutation test; P = 0.007). The impairment is due to the conditional knockdown of ap because heat-shock treatment did not affect LTM in GAL4 and UAS control flies (hs-GAL4/+ and UAS-ap RNAi/+ flies; S3 Fig). These results suggest that normal Ap function is required for the consolidation and maintenance of LTM. However, when flies were heat-shocked 3 hours before the test, LTM was intact (Fig 1F; HS−(3) versus HS+(3), Permutation test; P = 0.956). On the basis of the results of the qRT-PCR analysis (Fig 1C), the ap expression level must be reduced to approximately 50% of the control level during the test. Therefore, reduced Ap function does not have a critical effect on LTM retrieval. Under this condition, the timing of the initiation of heat-shock treatment is considered to be within the memory maintenance phase. However, the treatment did not affect LTM. Therefore, the reduction in Ap expression level and the duration of reduced Ap expression (≤3 hours) induced by the treatment may be insufficient to inhibit the LTM maintenance.

To examine the significance of Ap in the nervous system for memory consolidation and/or maintenance, we knocked down ap in neurons using UAS-ap RNAi in combination with several GAL4 lines. When a pan-neural nSyb-GAL4 line was used, 2 independent UAS-ap RNAi transgenes (NIG-fly and TRiP) both resulted in impaired LTM (S4A Fig), indicating that Ap in the nervous system is essential for LTM. In the following experiments, UAS-ap RNAi (NIG-fly) was used. To examine whether Ap in the Drosophila memory center is involved in LTM, we used 2 MB-GAL4 lines, OK107 and 30Y. In both lines, GAL4 is expressed in all MB lobes [32]. ap knockdown using these MB-GAL4 lines impaired LTM (S5B Fig). Furthermore, to define the particular MB neurons critical for courtship LTM, 3 GAL4 lines (R41C10, R55D03, and c305a) driving GAL4 expression in different neuronal subsets of MBs were used [9]. LTM was intact when Ap was knocked down in MB γ or α’/β’ neurons, whereas Ap knockdown in MB α/β neurons impaired LTM (Fig 2A, MI; R41C10/+ versus R41C10 / UAS-ap RNAi, Permutation test, P = 0.011; UAS-ap RNAi/+ versus R41C10 / UAS-ap RNAi, Permutation test; P = 0.033). In R41C10, GAL4 expression is controlled by a 3,500-bp fragment from the intronic region of ap. Both Jenelia’s Flylight project (https://flweb.janelia.org/cgi-bin/view_flew_imagery.cgi?line=R41C10↗) and our previous study [9] demonstrated that the reporter gene expression driven by R41C10 is primarily observed in MB αβ neurons. Although Jenelia’s Flylight project detected signals in optic lobes and visual projection neurons, the expression outside the MB αβ neurons is very weak and limited. Thus, the result with R41C10 indicates that MB αβ neurons are most likely responsible for Ap-dependent courtship LTM.

We next examined whether Ap-expressing neurons are present in MBs. To visualize Ap-expressing neurons, we first used an ap mutant allele ap^md544 with a P-element (pGawB) insertion (hereafter referred to as ap^GAL4). ap^GAL4 was previously shown to accurately report the expression of ap [33]. Flies homozygous for ap^GAL4 were lethal, but the heterozygous flies were viable [20]. In ap^GAL4/UAS-mCD8::GFP flies, GFP signals, which colocalized with Fas II, a marker of MB lobes, were primarily detected in a subset of MB αβ neurons but not in MB γ neurons or α’/β’ neurons (S6A Fig). Furthermore, they were abolished by MB-GAL80 (S6B Fig), indicating that ap^GAL4 signals indeed came from the MB neurons. Next, we used ap::GFP knock-in flies, which express a GFP reporter in a pattern consistent with endogenous Ap expression [34]. Ap::GFP and the nucleus-targeted mCherry reporter for MB α/β neurons were colocalized in many neurons (Fig 2B), and only a few neurons showed colocalization in MB γ or α’/β’ neurons (Fig 2C and 2D). Combined, these results support the conclusion that Ap is predominantly expressed in MB αβ neurons.

To clarify whether ap mutations induce structural defects in the MB, we used ap^GAL4 flies. Flies homozygous for ap^GAL4 were lethal, as was previously reported [20]. However, we were able to obtaine escapers of the F₁ hybrid of ap^GAL4 and ap^rk568 flies (ap^GAL4/ap^rk568) in which the ap function is severely reduced. We confirmed that they exhibit obvious structural defects of the MB with the α lobes branched into 2 regions (S7A Fig, arrows). By contrast, no such structural defects of the MB were identified in ap^GAL4/+ (S6A and S7B Figs). These results are consistent with the previous report indicating that escapers of the F₁ hybrid of ap^GAL4 and ap^P44 (a null allele) show severe morphological defects such as abnormal wings and an embryonic VNC structure, but that ap^GAL4/+ flies show no such abnormalities [20]. Furthermore, in ap^GAL4/+ flies as well as ap^null/+ and ap^rk568/+ flies, 1-hour memory after 1-hour conditioning (STM) was intact, whereas 5-day memory after 7-hour conditioning (LTM) was defective (S6C and S6D Fig). In summary, flies heterozygous for ap mutant alleles did not show obvious structural defects in the MB, and STM was intact. Nonetheless, they showed LTM impairment.

To further explore whether Ap in MB α/β neurons is responsible for memory consolidation or maintenance, we temporarily knocked down ap in MB α/β neurons using the TARGET system [35]. To knock down ap during the memory consolidation or maintenance phase, the temperature was increased to 30°C for 24 hours during 2 different experimental periods: (1) starting at 24 hours before the end of conditioning (conditioning phase) [Fig 3B, restrictive temperature (RT) (1)]; and (2) starting at 48 hours after the end of conditioning (memory maintenance phase) [Fig 3C, RT(2)]. When flies were kept at a permissive temperature (PT), they showed normal LTM regardless of their genotypes (Fig 3A). On the other hand, LTM was impaired when Ap was knocked down during the memory maintenance phase (Fig 3C), although it was intact when Ap was knocked down during the conditioning phase (Fig 3B). Thus, Ap in MB α/β neurons mainly contributes to LTM maintenance rather than memory consolidation.

Ap knockdown by hs-GAL4 shows that Ap is involved in both memory consolidation and maintenance (Fig 1). Since Ap in MB α/β neurons mainly contributed to LTM maintenance but not to consolidation (Fig 3C), it is likely that brain neurons other than MB α/β neurons are involved in Ap-dependent memory consolidation. We previously identified that Ap is expressed in Pdf neurons consisting of s-LNvs and l-LNvs [24]. Thus, we next examined whether ap knockdown in Pdf neurons affects LTM. First, the following 3 GAL4 lines were used: (1) Pdf-GAL4, which drives GAL4 expression in both s-LNvs and l-LNvs; (2) c929, which drives GAL4 expression in peptidergic neurons including l-LNvs [36]; and (3) R18F07, which drives GAL4 expression in s-LNvs and only weakly in one of the l-LNvs [9]. When Pdf-GAL4 and c929 were used to knock down ap, LTM was impaired (Fig 4A; Permutation test; in Pdf-GAL4/UAS-ap RNAi, versus UAS control, P < 0.001, versus GAL4 control, P < 0.001; in c929/UAS-ap RNAi, versus UAS control, P < 0.001, versus GAL4 control, P = 0.001), whereas ap knockdown by R18F07 did not impair LTM (Fig 4A; in R18F07/UAS-ap RNAi, versus UAS control, P = 0.099, versus GAL4 control, P = 0.916). These results suggest that Ap in l-LNvs is necessary for LTM. Since GAL4 expression in c929 is detected in the neuronal subset of the abdominal ganglion [37] and Pdf neuropeptide is also expressed in the abdominal ganglion [38], Ap in the abdominal ganglion may be necessary for LTM. Thus, we next used a GAL4 line, R14F03, which drives GAL4 expression in l-LNvs but not in the abdominal ganglion (https://flweb.janelia.org/cgi-bin/view_flew_imagery.cgi?line=R14F03↗). If Ap in the abdominal ganglion is essential for LTM, ap knockdown using R14F03 should not affect LTM. However, R14F03/UAS-ap RNAi flies showed LTM impairment (Fig 4B), indicating that Ap in l-LNvs is necessary for LTM. Next, to determine whether Ap in l-LNvs but not in other brain neurons is essential for LTM, we performed l-LNv–specific Ap knockdown using the Flp-out system [39] with c929 and R61G12-LexA. In R61G12-LexA, LexA is expressed in l-LNvs and s-LNvs [9]. Using this system, we can knock down targeted genes specifically in the c929 and R61G12-LexA-coexpressing neurons. The effectiveness of the Flp-out system was confirmed using the GFP reporter. In control flies carrying c929, R61G12-LexA, LexAop-FLPL, and UAS>STOP> GFP, the GFP signal was detected in all l-LNvs but not in s-LNvs (Fig 4C). As shown in Fig 4D, the Flip-out experiments with UAS>STOP>ap RNAi demonstrated that l-LNv–specific ap knockdown impaired LTM (Permutation test, P = 0.002). This result also supports the conclusion that Ap in l-LNvs is indispensable for LTM.

Next, we examined when ap in Pdf neurons is required during processing for LTM. In contrast to temporal knockdown in MB α/β neurons, LTM was impaired when Ap was knocked down during conditioning but not during maintenance (Fig 3B; Permutation test; P = 0.019). These findings indicate that Ap in Pdf neurons mainly contributes to memory consolidation rather than LTM maintenance.

Since cell type–specific ap knockdown experiments revealed that sufficient ap function is required for normal LTM, we next examined whether ap expression in MB α/β and/or Pdf neurons can rescues the LTM phenotype in ap^null/+ flies. If 1-day memory impairment after 7-hour conditioning in ap^null/+ flies is due to defective memory consolidation resulting from the reduced function of Ap in Pdf neurons, the ability of ap^null/+ flies to show 1-day memory should be restored by expressing WT ap in Pdf neurons. As shown in Fig 5A, the targeted expression of ap in Pdf neurons rescued the impairment of 1-day memory in ap^null/+ flies (Fig 5A; Permutation test; P < 0.001). However, the targeted expression of ap in MB α/β neurons did not rescue the impairment of 1-day memory in ap^null/+ flies (Fig 5A; Permutation test; P = 0.130). Furthermore, Pdf neuron–specific ap expression did not rescue impairment of memory on day 2 after 7-hour conditioning in ap^null/+ flies (Fig 5B, 2-day memory; Permutation test, P = 0.496). These findings indicate that Pdf neuron–specific Ap expression in ap^null/+ flies is insufficient to maintain LTM for 2 days. For 5-day memory, the targeted expression of ap in either Pdf or MB α/β neurons was not sufficient to rescue the ap^null/+ phenotype (Fig 5D; Permutation test, versus Pdf-GAL4, P = 0.778, versus R41C10, P = 0.259). However, when ap was expressed in both Pdf and MB α/β neurons using Pdf-GAL4; R41C10 flies (Fig 5C), LTM impairment in ap^null/+ flies was rescued (Fig 5D; Permutation test; P = 0.042). These findings support the idea that Ap in Pdf neurons is responsible for memory consolidation, whereas that in MB α/β neurons is responsible for LTM maintenance.

Since the transcriptional activity of Ap requires the formation of a protein complex with a cofactor, Chi [23,40], we reasoned that Chi is also involved in LTM. To investigate this possibility, a null allele Chi^e5.5 (hereafter referred to as Chi^null) was used [41]. Since Chi^null is also homozygous lethal as was observed in ap^null, we used heterozygous mutant flies (Chi^null/+). Unlike the LTM phenotype in ap^null/+, 1-day memory after 7-hour conditioning was not impaired in Chi^null/+ flies (Fig 6A; Permutation test, P = 0.087). Since a 50% reduction of Chi function in Chi^null/+ flies may be insufficient to induce LTM impairment, we further knocked down Chi in Pdf neurons in Chi^null/+ flies and examined the effect of this knockdown on LTM. The effectiveness of Chi RNAi (VDRC) was confirmed by qRT-PCR using a pan-neuronal GAL4 line (nSyb-GAL4); Chi RNA levels were reduced by about 55% (Fig 6B; Scheffe’s multiple comparisons, GAL4 control versus F₁, P < 0.001, UAS control versus F₁, P < 0.001). Even when Chi was knocked down in a Pdf neuron–specific manner in Chi^null/+ background flies, 1-day memory was not affected (Fig 6C; Permutation test, P = 0.488). In contrast to 1-day memory, 5-day memory in Chi^null/+ flies was impaired (Fig 6D, Permutation test, P = 0.026), indicating that Chi is involved in LTM maintenance rather than in memory consolidation.

To verify that Chi is required in neurons for 5-day memory, nSyb-GAL4/UAS-Chi RNAi (VDRC) and nSyb-GAL4/UAS-Chi RNAi (TRiP) flies were used. We found that the pan-neuronal knockdown of Chi with 2 independent UAS-Chi RNAi lines both impaired 5-day memory (S4B Fig). In the following experiments, UAS-Chi RNAi (VDRC) was used. We confirmed that Chi knockdown in MB α/β neurons induces 5-day memory impairment (Fig 6E; Permutation test, R41C10/UAS-Chi RNAi versus UAS control, P = 0.007, R41C10/UAS-Chi RNAi versus GAL4 control, P = 0.015). However, Chi knockdown in Pdf neurons had no effect on LTM (Fig 6E). Next, we temporarily knocked down Chi in MB α/β neurons to examine when Chi is required in these neurons during memory processing for LTM. LTM was impaired when Chi was knocked down during the memory maintenance phase but not during the conditioning phase (Fig 7C; Permutation test; P = 0.002). Thus, we concluded that Chi in MB α/β neurons contributes to memory maintenance rather than LTM consolidation. Taken together, these findings support the idea that Ap cooperates with Chi in MB α/β neurons to maintain LTM, but plays a role in l-LNvs to consolidate memory independently of Chi.

To determine whether neurotransmission from Pdf neurons is necessary for proper memory consolidation, we used the temperature-sensitive Dynamin mutation shibire^ts1 (shi^ts1). The targeted expression of shi^ts1 can inhibit neurotransmission in a spatially specific and temperature-dependent manner [42]. Pdf-GAL4/UAS-shi^ts1 flies showed LTM at PT (Fig 8A). We found that the disruption of neurotransmission during the conditioning phase impaired LTM (Fig 8B), but not during the memory maintenance or test phase (Fig 8C and 8D). Thus, neurotransmission from Pdf neurons is necessary for proper memory consolidation. In addition, we performed the electrical silencing of Pdf neurons using the inwardly rectifying Kir2.1 channel combined with the TARGET system. For the silencing of Pdf neurons during memory consolidation, we shifted the temperature from PT to RT and vice versa during the conditioning phase. As was observed in the disruption of neurotransmission using shi^ts1, the electrical silencing of Pdf neurons during conditioning impaired LTM (Fig 8E).

Our results show that Ap in Pdf neurons is necessary for memory consolidation in a Chi-independent manner (Figs 3, 5, and 6). Since both the disruption of neurotransmission and the electrical silencing mimic the effect of Ap loss of function and impair memory consolidation, ap mutations or knockdown may reduce the excitability of Pdf neurons. A Drosophila ionotropic GABA_A receptor (GABA_AR), Resistant to Dieldrin (Rdl), is expressed in Pdf neurons. Anti-RDL antibody staining reveals that RDL is highly expressed in l-LNv somata, while little or no expression is observed in s-LNv somata [15, 43]. Furthermore, electrophysiological analysis revealed that l-LNvs respond to GABA [43]. Considering the physiological properties of l-LNvs, we next investigated the possibility that Ap in l-LNvs is involved in the response to GABA.

To visualize the response to GABA in l-LNvs, the FRET-based Cl⁻ probe, SuperClomeleon, was used [44,45]. First, in flies with WT ap, we confirmed robust Cl⁻ responses to 400 μM GABA in l-LNvs in the presence of TTX, while the responses were blocked by the GABA_AR antagonist picrotoxin (Fig 9A and 9B). Similar Cl⁻ responses were observed in heterozygous Chi^null flies (Fig 9C and 9D). Compared with WT and heterozygous Chi^null flies, heterozygous ap^null flies showed robust increases in Cl⁻ responses (Fig 9C and 9D), indicating that the response to GABA in l-LNvs is augmented when the ap function is suppressed. Since Rdl is also expressed in MB neurons [46], we investigated whether Ap in MB α/β neurons is also involved in the response to GABA. As was observed in l-LNvs, Cl⁻ responses in MB α lobes in heterozygous ap^null flies, but not in heterozygous Chi^null flies, were greater than those in WT flies (S8A and S8B Fig). These results indicate that Ap is necessary for appropriate Cl⁻ responses to GABA in a Chi-independent manner.

In Pdf neurons, ap knockdown impaired 1-day memory after 7-hour conditioning (Fig 4), while Chi knockdown did not (Fig 6E). Similarly, increased responses to GABA in l-LNvs were detected in ap^null/+ but not in Chi^null/+. Thus, the overresponses to GABA in l-LNvs may cause 1-day memory impairment in ap^null/+ flies. If the reduced Ap expression in ap^null/+ leads to a decrease in l-LNv excitability due to augmented responses to the inhibitory neurotransmitter GABA and the exaggerated inhibition of LNv excitability causes the 1-day memory impairment, the 1-day memory phenotype in heterozygous ap^null flies may be compensated for by the reduced Rdl expression in l-LNvs. As we expected, the knockdown of Rdl in Pdf neurons compensated for the impaired 1-day memory in ap^null/+ flies (Fig 9E). Furthermore, the Pdf neuron–specific overexpression of Rdl in WT background induced 1-day memory impairment (Fig 9F). This result is consistent with the aversive effect of the electrical silencing of Pdf neurons on LTM (Fig 8).

Since increased responses to GABA in MB α lobes were also detected in ap^null/+ (S8 Fig), it is possible that the overresponse to GABA in MB α/β neurons is the cause of the impairment of 5-day memory in ap^null/+ flies. However, unlike the Pdf neurons, the overexpression of Rdl in MB α/β neurons driven by R41C10 did not affect 5-day memory (S8C Fig).

All flies were raised on glucose–yeast–cornmeal medium in 12:12 LD cycles at 25.0 ± 0.5°C (45% to 60% relative humidity). Virgin males and females were collected without anesthesia within 8 hours after eclosion. The fly stocks used for this study were as follows: WT Canton-S (CS), ap^rk568 [Bloomington stock number (BL) 5374)], ap^UGO35 (provided by Dr. Manfred Frasch, University of Erlangen-Nuremberg), ap^md544 (BL3041), ap::GFP (BL38423), Chi^e5.5 (Kyoto 107789), Pdf-GAL4 (BL6900), c929 (BL25373), R18F07 (BL47876), R14F03 (BL69564), R61G12 (BL41286), R61G12-LexA (BL52685), R41C10 (BL50121), R55D03 (BL47656), c305a (BL30829), nSyb-GAL4 (BL51635), hs-GAL4 [31], OK107 [31], 30Y [31], MB-LexA [64], UAS-shi^ts1 [42], UAS-Kir2.1::eGFP (BL6596), UAS-mCD8::GFP (BL5137), UAS-mCherry::NLS (BL38424), UAS-ap RNAi (NIG-fly, 8376R-1), UAS-ap RNAi-TRiP (BL41673), UAS-ap (see next section), UAS-Chi RNAi (VDRC, 30454), UAS-Chi RNAi-TRiP (BL35435), UAS-Rdl (BL29036), UAS-Rdl RNAi (VDRC, 41103), UAS-SuperClomeleon (BL59847), LexAop-SuperClomeleon (BL59846), tub-GAL80^ts (BL7017), LexAop2-FLPL (BL55820), UAS>stop>mCD8::GFP (BL30032), and UAS>stop>ap RNAi (see next section). All lines used for behavior experiments except for ap^UGO35, Chi^e5.5, UAS-mCD8::GFP, and UAS>stop>mCD8::GFP were outcrossed for at least 5 generations to white¹¹¹⁸ flies with the CS genetic background.

Full-length ap cDNA was synthesized by RT-PCR with adult fly head RNA and 2 primers, 5′-GCGGCCGCCAAAATGGGCGTCTGCACCGAGGAGCGC-3′ and 5′-TCTAGATTAGTCCAAGTTAAGTGGCGGTGTGC-3′. The PCR product was digested with NotI and XbaI, and cloned into a pBluescript (pBS) II SK(+). The ap cDNA was subcloned into the NotI/XbaI-digested pUAST attB vector [65]. Constructs of UAS-ap were injected into eggs of PBac{y[+]-attP-9A VK00005 (BL24862).

For the generation of the UAS-FRT-stop-FRT-ap RNAi construct (UAS>stop>ap RNAi), an ap RANi fragment was obtained by PCR from the genomic DNA of UAS-ap RNAi (NIG-fly, 8376R-1). Subsequently, it was inserted into the pUAST attB vector using an In-Fusion HD Cloning Kit (Takara Bio, Japan). The primer sequences used for the PCR are as follows: forward, 5′-AACAGATCTGCGGCCGCATAACGCGCAACCTCGAC-3′; reverse, 5′-ACAAAGATCCTCTAGAGGAACAATGCTCCGACTAG-3′. Next, the FRT-stop-FRT cassette (<stop<) was PCR-amplified from the UAS<stop<mCD8::GFP vector (Addgene, 24385) and then cloned into the pUAST attB vector containing the ap RNAi fragment by using an In-Fusion HD Cloning Kit. The primer sequences used for the PCR are as follows: forward, 5′-AGGGAATTGGGAATTCGAAGTTCCTATTCCGAAG-3′; reverse, 5′-ATCTGTTAACGAATTCGAAGTTCCTATACTTTCTAG-3′. The UAS>stop>ap RNAi construct was also injected into eggs of PBac{y[+]-attP-9A}VK00005.

The courtship conditioning assay was carried out as previously described [9]. For LTM, a 3- to 5-day-old male was placed with a mated female (4 to 7 day olds) in a conditioning chamber (15-mm diameter, 5-mm depth) containing food for 7 hours either with (conditioned) or without (naive) a single premated female (7-hour conditioning). If males remated with mated females during conditioning, we discarded such males after conditioning. After 7-hour conditioning, only flies showing courtship behaviors toward the mated female but not copulating successfully were transferred to a glass tube with food (12-mm diameter × 75-mm depth) and kept in isolation for 1, 2, or 5 days until the test. For STM, a 3- to 5-day-old male was placed with a mated female (4 to 7 day olds) in a conditioning chamber (15-mm diameter, 5-mm depth) without food for 1 hour either with (conditioned) or without (naive) a single premated female (1-hour conditioning). After 1-hour conditioning, only flies showing courtship behaviors toward the mated female but not copulating successfully were transferred to a glass tube with food (12 mm diameter × 75 mm depth) and kept in isolation for 1, 8, or 24 hours until the test.

The test was performed using a freeze-killed virgin female in a test chamber (15-mm diameter, 3-mm depth). All procedures in the experiments were carried out at 25 ± 1.0°C (45% to 60% relative humidity) except for the temperature shift experiments. The male courtship activity of individual flies was evaluated as a CI, defined as the percentage of time spent in performing courtship behaviors during a 10-minute observation period. We first measured the CI valiues of conditioned and naive males (CI_Conditioned and CI_Naive), and then mean CI_Naive was calculated. To quantify courtship memory, the MI was calculated using the following formula: MI = (mean CI_Naive − mean CI_Conditioned) /mean CI_Naive.

In F₁ males between hs-GAL4 and UAS-ap RNAi flies, the ap expression was inhibited after heat-shock treatment. For qRT-PCR analysis, hs-GAL4/+, UAS-ap RNAi/+, and hs-GAL4/ UAS-ap RNAi flies were heat-shocked (37°C) for 20 minutes, and total RNA was extracted 3 hours after heat-shock treatment. For courtship conditioning assay, hs-GAL4/UAS-ap RNAi flies were heat-shocked 3 hours before conditioning, immediately after conditioning, or 3 hours before the test.

The temperature-sensitive allele shibire^ts1 (shi^ts1) is defective in Dynamin function at an RT. In F₁ males between Pdf-GAL4 and UAS-shi^ts1, shi^ts1 is expressed in Pdf neurons. In these males, neurotransmission in Pdf neurons should be disrupted at RT but not at a PT (25°C). To disrupt neurotransmission in Pdf neurons during the memory consolidation, maintenance, or test phase, the temperature was increased to RT (32°C) during 3 experimental periods: conditioning phase, 48 to 72 hours after conditioning (memory maintenance phase), and 12 hours before the test initiation.

The tub-GAL80^ts transgene used in the TARGET system [35] encodes a ubiquitously expressed and temperature-sensitive GAL4 repressor that is active at PT (25°C) but not at RT (30°C). By using UAS-ap RNAi or UAS-Chi RNAi combined with the TARGET system, we knocked down ap in GAL4-positive neurons at RT, but not at PT. We shifted PT to RT and vice versa during 2 experimental phases: 24 hours before the end of conditioning and 48 to 72 hours after conditioning. To drive the expression of Kir2.1 in Pdf neurons during memory consolidation, flies were kept at RT during conditioning.

Pdf neurons are classified into 2 neural clusters, s-LNvs and l-LNvs. To assay whether l-LNv–specific ap knockdown affects LTM, 2 binary gene expression systems (GAL4/UAS and LexA/LexAop) combined with Flippase (FLP/FRT) were used. The specific target gene is expressed in GAL4- and LexA-coexpressing neurons utilizing this system. R61G12-LexA, c929, and UAS>stop>ap RNAi lines were used in the experiments.

For ap, TRizol (Invitrogen, USA) was used for collecting total RNA from about 30 male fly heads in each genotype. For Chi, a PicoPure RNA Isolation Kit (KIT0204, Thermo Fisher Scientific, USA) was used for collecting total RNA from 3 whole brains in each genotype. cDNA was synthesized by the reverse transcription reaction using a QuantiTect Reverse Transcription Kit (#205311, QIAGEN, USA). qRT-PCR was carried out using a Chromo 4 detector (CFB-3240, MJ Research) and the SYBR Premix Ex Taq (Takara Bio, Japan) for ap or the THUNDERBIRD SYBR qPCR Mix (QPS-201, TOYOBO) for Chi. The primer sequences used for qRT-PCR were as follows: ap-Forward, 5′- ATAACGCGCAACCTCGACGAC-3′; ap-Reverse, 5′- CATGAGGATTCCCGTTCCAGC-3′; Chi-Forward, 5′- AACGGGCCGTGAAAAGTGTG-3′; Chi-Reverse, 5′- GTGGTCGGTTCTATCGGGCA -3′; rp49-Forward, 5′-AAGATCGTGAAGAAGCGCAC-3′; rp49-Reverse, 5′-TGTGCACCAGGAACTTCTTG-3′. The expression level of each mRNA was normalized to that of rp49 mRNA. The average of the normalized mRNA expression levels in control flies was calculated using data from 5 or 6 independent assays.

Immunohistochemistry was performed as previously described [24]. For Pdf staining, brains were stained with a mouse anti-Pdf antibody (PDF C7-s, Developmental Studies Hybridoma Bank at the University of Iowa, 1:200) followed by Alexa Fluor 568 anti-mouse IgG (A11004, Thermo Fisher Scientific) as the secondary antibody (1:1,000). For GFP staining, brains were stained with a rabbit anti-GFP antibody (A11122, Thermo Fisher Scientific, 1:200), followed by Alexa Fluor 488 anti-rabbit IgG (A11008, Thermo Fisher Scientific, 1:1,000) as the secondary antibody. Fluorescence signals were observed under a confocal microscope [(LSM710, Zeiss, Germany) or (C2, Nikon, Japan)].

Brains were prepared for imaging analysis as previously described with some modifications [66]. Briefly, brains were extracted in ice-cold Ca²⁺-free HL3 medium (in mM, NaCl, 70; sucrose, 115; KCl, 5; MgCl₂, 20; NaHCO₃, 10; trehalose, 5; Hepes, 5) [67]. Phenol red was used as a pH indicator (final concentration, 0.5 mg/ml) to adjust the pH of buffers by coloring. For the adjustment of pH, CO₂ gas was dissolved in buffers so that the color became orange (pH 7.0 ± 0.2). The brains were treated with papain (10 U/ml, activated by 15-minute incubation with 0.8 mM EDTA at 37°C) for 15 minutes at RT and then washed several times with Ca²⁺-free HL3 medium. After papain treatment, the brains were incubated with standard Drosophila HL3 medium (in mM, CaCl₂, 1.8; NaCl, 70; sucrose, 115; KCl, 5; MgCl₂, 20; NaHCO₃, 10; trehalose, 5; Hepes, 5) with TTX alone (1 μM) or with TTX (1 μM) and PTX (100 μM). During incubation, fresh medium was infused into the chamber using a peristaltic pump (AC-2110, ATTO, Japan) every 5 to 10 minutes.

For Cl⁻ imaging using SuperClomeleon, fluorescence images were captured at 0.5 Hz at 5-second intervals using a confocal microscopy system (C2, Nikon) equipped with a 20× dry objective (NA, 0.75; Nikon). The cyan fluorescent protein (CFP) was excited at 458 nm and detected using a 482 ± 17.5 nm band-pass filter, and the yellow fluorescent protein (YFP) was detected simultaneously using a 540 ± 15 nm band-pass filter. GABA was diluted in the incubation medium so that the final concentration became 400 μM, and 1.6 ml of the GABA solution was perfused 90 seconds after the start of capturing images. To calculate fluorescence resonance energy transfer (FRET) changes, the following analysis was performed using custom-made software developed in MATLAB (MathWorks, Japan). For the Cl⁻ imaging of l-LNvs, regions of interest (ROIs) were selected as a circle within or surrounding each l-LNv soma to measure the average F of CFP and YFP at each time point. For the Cl⁻ imaging of MB α/β neurons, ROIs were selected as a circle within each α lobe tip. We calculated FRET changes as R using the following formula: R = average F of CFP/average F of YFP. We calculated the initial R (R₀) by averaging the R values recorded from 10 sequential frames before stimulation. To obtain ΔR/R₀ (%) as Cl⁻ responses, we calculated (R–R₀)/R₀ × 100 at each time point.

All the statistical analyses were performed using IBM SPSS Statistics 22 (IBM Japan) or BellCurve for Excel (Social Survey Research Information, Japan), except for the comparisons of MI. In all statistical analyses except for the comparisons of MI, the Kolmogorov–Smirnov test was used to determine whether the data are normally distributed. In the statistical analysis of CI, when basic data were not distributed, normally, we carried out the log transformation of the data. Even though the basic data or transformed data are normally distributed, heteroscedasticity was detected in all data. Thus, we used the Mann–Whitney U test for comparisons. In the statistical analysis of MI, the permutation test with 10,000 random permutations was used (H₀, the difference between experimental and control groups is 0). The free statistical package R was used for these tests [68]. In the qRT-PCR of ap knockdown, Student t test or the Mann–Whitney U test was used for comparisons between HS− and HS+. In the qRT-PCR of Chi knockdown, 1-way ANOVA followed by post hoc analysis using Scheffe test was used for multiple comparisons. In functional fluorescence imaging, the basic data related to picrotoxin treatment were distributed normally and homoscedasticity was evident. Thus, Student t test was carried out. In the Cl⁻ imaging of l-LNvs, heteroscedasticity was evident in multiple comparisons among 3 genotypes (WT, ap^nill/+, and Chi^null/+ flies). Therefore, nonparametric ANOVA (Kruskal–Wallis test) followed by post hoc analysis using the Steel–Dwass test was carried out. In the Cl⁻ imaging of MB α lobes, the log-transformed data were distributed normally, and homoscedasticity was evident. Thus, 1-way ANOVA followed by post hoc analysis using Scheffe test was carried out. The numerical data used in all figures are included in S1 Data.